G85613 (acsbg1,LOC102779547)


Basic Information

Item Value
gene id G85613
gene name acsbg1,LOC102779547
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053119.1
NCBI id CM020916.1
chromosome length 42187026
location 17544155 ~ 17544405 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU115317
ACCCAGCTCTCCTCCAGAAACAGAGAAGTCCTTTCTTAGAATAGTCCACTTTTGTATGCGCTGGGCATTAGAGGTGGCTGCAGCGTTGACCCTGTTGATTCCTTCTTGAATGGTCCGGTACACGTCTTTGTCTTTTCCCCCAATGATGTCAGACACCTTGGTTGCTTGGCTTCCTAGCTGTTGGCAAAGCTCCACAGCCTCCATACTCAGCTCCTCTGTTGGCTCCATGGTTTCTGTATTGCTACAACACT

Function

symbol description
acsbg1 Predicted to enable long-chain fatty acid-CoA ligase activity. Predicted to be involved in long-chain fatty acid biosynthetic process. Predicted to be active in cytoplasm. Human ortholog(s) of this gene implicated in adrenoleukodystrophy. Orthologous to human ACSBG1 (acyl-CoA synthetase bubblegum family member 1).

NR:

description
PREDICTED: long-chain-fatty-acid--CoA ligase ACSBG1 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU115317 True 251 lncRNA 0.49 1 17544155 17544405

Neighbor

gene id symbol gene type direction distance location
dnaja dnaja4,LOC108229883,LOC107099226,LOC106514380 coding downstream 6309 17534304 ~ 17537846 (-)
LOC120564505 rab8b,LOC103379973 coding downstream 13527 17527783 ~ 17530628 (-)
klf13 klf13,znf746 coding downstream 56581 17475744 ~ 17487574 (-)
LOC120563560 LOC102312947,LOC102081637 coding downstream 119824 17407989 ~ 17424331 (-)
gcnt3 NA coding downstream 136252 17406196 ~ 17407903 (-)
idh3a idh3a,LOC103353692,LOC100691871 coding upstream 940 17545345 ~ 17550219 (-)
lrrc61 lrrc61 coding upstream 6928 17551333 ~ 17554942 (-)
LOC120563723 NA coding upstream 21836 17566241 ~ 17572209 (-)
LOC120563319 LOC102079624,LOC102777822,LOC103353701 coding upstream 64695 17609100 ~ 17617514 (-)
usp3 usp3 coding upstream 98440 17642845 ~ 17656358 (-)
G85601 LOC101478969,LOC102214964,LOC102308915,LOC100701437,LOC102780768 non-coding downstream 26988 17515903 ~ 17517167 (-)
LOC120563415 NA non-coding downstream 448392 17090105 ~ 17095763 (-)
G85481 etfa non-coding downstream 622013 16920449 ~ 16922142 (-)
G85462 scaper,LOC102788151 non-coding downstream 641834 16901164 ~ 16902321 (-)
G85460 scaper non-coding downstream 644360 16897684 ~ 16899795 (-)
G85660 NA non-coding upstream 112740 17657145 ~ 17657371 (-)
G85711 NA non-coding upstream 197287 17741692 ~ 17742006 (-)
G85799 NA non-coding upstream 285103 17829508 ~ 17834884 (-)
G85802 arih1,LOC107662282,LOC107591299 non-coding upstream 297695 17842100 ~ 17845786 (-)
G85806 NA non-coding upstream 344462 17888867 ~ 17892467 (-)
G85435 NA other downstream 735739 16808056 ~ 16808416 (-)
trnah-gug_10 NA other downstream 779369 16764715 ~ 16764786 (-)
LOC120563869 frmd5,LOC104917831,LOC102299895,LOC106561170 other downstream 780437 16697095 ~ 16763718 (-)
G85321 NA other downstream 1103190 16439374 ~ 16440965 (-)
st8sia2 fam174b,st8sia2,LOC100690985,LOC101474125,LOC102798331 other downstream 1334969 16188853 ~ 16209186 (-)
fbxl22 fbxl22 other upstream 81606 17626011 ~ 17645520 (-)
ppcdc ppcdc other upstream 317308 17861713 ~ 17877065 (-)
dennd4a dennd4a other upstream 349448 17893853 ~ 17956629 (-)
trnaq-cug_6 NA other upstream 382642 17927047 ~ 17927118 (-)
G85813 rpl4 other upstream 486603 18031008 ~ 18036276 (-)

Expression


Co-expression Network