G86652 (reln)


Basic Information

Item Value
gene id G86652
gene name reln
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053119.1
NCBI id CM020916.1
chromosome length 42187026
location 20241433 ~ 20241850 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU116779
CAATGGGTGTTTCCTCCTGCTCACTCAGCTGCCCTACTCTTCCTGCGGTCCCATCAGCAGGAGCTCTCTCATGGTTGGGCAGCGCCACGCCTCCAAATGTGTCAGATATCTGTGCTCGTGGATCTGAGCCTGCGATGAGGACGTTATCCAGAGCCCAATCACTGTGGTCTGCTCCCTCATGTTGTGGCTGCCACCAGCGCACACGCACTCCCTCCTGACGGGCAGCAGGGGGCAGCAGCACATTCACAAACCCAGGCTTGGTGTACAGATCATAGAAGATCTCTGTCAGTAGATGCCAGTTGATA

Function

symbol description
reln Predicted to enable hydrolase activity; lipoprotein particle receptor binding activity; and metal ion binding activity. Acts upstream of or within cerebellar Purkinje cell layer morphogenesis. Predicted to be located in extracellular region. Is expressed in immature eye and nervous system. Human ortholog(s) of this gene implicated in Norman-Roberts syndrome; autistic disorder; familial temporal lobe epilepsy 7; and schizophrenia. Orthologous to human RELN (reelin).

NR:

description
PREDICTED: reelin

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU116779 True 305 lncRNA 0.56 2 20241433 20241850

Neighbor

gene id symbol gene type direction distance location
LOC120564471 LOC104960979,LOC103355225,LOC103150264,LOC103466396,LOC106915861 coding downstream 126049 20088128 ~ 20115384 (-)
si:dkey-29p10.4 NA coding downstream 157833 20075491 ~ 20083600 (-)
LOC120564329 tp53i11 coding downstream 182310 20016169 ~ 20059123 (-)
cd82b LOC103355222 coding downstream 229123 19987783 ~ 20012310 (-)
tspan18b tspan18 coding downstream 286618 19885911 ~ 19954815 (-)
bncr NA coding upstream 10949 20252799 ~ 20255338 (-)
LOC120563520 NA coding upstream 13516 20255366 ~ 20256420 (-)
LOC120563522 NA coding upstream 14594 20256444 ~ 20257777 (-)
LOC120563518 plcz1,LOC104942417,LOC106523397,LOC108229959 coding upstream 34027 20275877 ~ 20293118 (-)
LOC120564552 LOC103358309,LOC104963723 coding upstream 348452 20590302 ~ 20596104 (-)
G86605 NA non-coding downstream 225621 20014338 ~ 20015812 (-)
G86575 lmo2 non-coding downstream 418060 19821540 ~ 19823373 (-)
G86566 NA non-coding downstream 464390 19774307 ~ 19777043 (-)
G86549 NA non-coding downstream 516240 19723973 ~ 19725193 (-)
G86543 LOC104950121,LOC106908881,LOC103380454 non-coding downstream 545618 19694995 ~ 19695815 (-)
G86660 NA non-coding upstream 9040 20250890 ~ 20264206 (-)
G86686 NA non-coding upstream 160894 20402744 ~ 20461823 (-)
G86761 NA non-coding upstream 456965 20698815 ~ 20699637 (-)
G86853 NA non-coding upstream 666539 20908389 ~ 20908590 (-)
G86976 NA non-coding upstream 860780 21102630 ~ 21103379 (-)
cep152 cep152,LOC104960117 other downstream 667745 19557452 ~ 19573688 (-)
G86402 LOC103363837 other downstream 852858 19387822 ~ 19388575 (-)
arpp19b arpp19,LOC100693429,LOC102791975,LOC106919339,LOC101065895 other downstream 923955 19315385 ~ 19317478 (-)
LOC120564082 svip other downstream 1080946 19156758 ~ 19160487 (-)
G86194 tph1 other downstream 1230517 19007196 ~ 19010916 (-)
G86638 NA other upstream 10789 20252639 ~ 20259259 (-)
LOC120564033 LOC103358331,LOC102195670 other upstream 565032 20806882 ~ 20829235 (-)
LOC120563850 NA other upstream 635818 20877668 ~ 20887626 (-)
dnajb9a dnajb9,LOC100706374,LOC102775779,LOC102215328 other upstream 1127681 21369531 ~ 21372509 (-)
G87140 NA other upstream 1471192 21713042 ~ 21713554 (-)

Expression


Co-expression Network