G87964 (tsg101)


Basic Information

Item Value
gene id G87964
gene name tsg101
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053119.1
NCBI id CM020916.1
chromosome length 42187026
location 25735499 ~ 25736123 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU118491
TTGAGAAAAACCTCCAGGTCTATGACGCCCCTGCGGAGGGCCTCTCCCAGGTAGAAGATGGTGTCCTCAATTGCATTTTCTTCGGCATAAAGGTTCAGGATCTGTTTGTACAGCGGAGCTGTCGGCACGATGACGTCGTCGATGTCGTTGTTCTCGGACTGGTTCTCCATCTTCTCCAAGGCCTCGCTCAGCTCCTCATCCTTTCTCTTCAGCAGCTCGATATTCCTGTCGACCTCAGACACTTCCTGGTCCAGCCTTGAGACCATCTCCTCCAGCTTCTGATGTCCTTTCTTCAGGTCCTCCTCGGTTCGCTTCAGGGCGTCCAGCTCCGCCTGAGCTCTGTCCATCTCCTCCTTCATCCTCCAGCGAAGCTTGTCGCTCACAGCTGAGATCAGAGATGCGCGGATGGTGTCCTCGCCAATGGTGCCATCTCTGCTCGGGCCTTAAGAGGAAAAGATTTAGATGGGACGTGAGACAGTGAACAGACATAACAGAAA

Function

symbol description
tsg101 Enables several functions, including protein homodimerization activity; ubiquitin protein ligase binding activity; and virion binding activity. Involved in several processes, including positive regulation of exosomal secretion; positive regulation of viral life cycle; and regulation of protein kinase activity. Located in several cellular components, including endosome; extracellular exosome; and nucleolus. Part of ESCRT I complex. Implicated in breast cancer; breast carcinoma; cervix carcinoma; endometrial adenocarcinoma; and prostate cancer. Biomarker of breast cancer and ovarian cancer.

NR:

description
PREDICTED: tumor susceptibility gene 101 protein

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU118491 True 497 lncRNA 0.54 2 25735499 25736123

Neighbor

gene id symbol gene type direction distance location
lrrc56 LOC106573360 coding downstream 32827 25692735 ~ 25702672 (-)
rassf7a rassf7 coding downstream 46821 25651752 ~ 25688678 (-)
ascl1b LOC103357271,LOC100706722,LOC104920455,LOC101171241 coding downstream 117516 25616361 ~ 25617983 (-)
pamr1 LOC103357277 coding downstream 348187 25302836 ~ 25387312 (-)
slc1a2b slc1a2 coding downstream 441542 25262241 ~ 25293957 (-)
ldha LOC104920463,LOC100534427 coding upstream 2825 25738948 ~ 25748198 (-)
abtb2b abtb2 coding upstream 240277 25976400 ~ 26027084 (-)
b4galnt4a b4galnt4 coding upstream 296272 26032395 ~ 26190006 (-)
tmem86a tmem86a coding upstream 473722 26209845 ~ 26226797 (-)
si:dkeyp-19e1.3 LOC103366057,LOC107688560,LOC107553860 coding upstream 507823 26243946 ~ 26267018 (-)
G87961 NA non-coding downstream 85382 25649329 ~ 25650117 (-)
LOC120564131 NA non-coding downstream 239194 25425552 ~ 25496305 (-)
G87888 NA non-coding downstream 291077 25442937 ~ 25444422 (-)
G87883 NA non-coding downstream 370724 25364568 ~ 25364775 (-)
G87876 fjx1 non-coding downstream 381375 25351256 ~ 25354124 (-)
LOC120563936 NA non-coding upstream 141577 25877700 ~ 25880981 (-)
G87977 NA non-coding upstream 218215 25954338 ~ 25956429 (-)
G87986 NA non-coding upstream 238669 25974792 ~ 25975152 (-)
G88016 NA non-coding upstream 362434 26098557 ~ 26098811 (-)
G88032 NA non-coding upstream 493480 26229603 ~ 26231320 (-)
phrf1 NA other downstream 88499 25630776 ~ 25647000 (-)
G87897 NA other downstream 138738 25596353 ~ 25596761 (-)
G87803 NA other downstream 670011 25064752 ~ 25065488 (-)
LOC120563922 NA other downstream 1819297 23909169 ~ 23916202 (-)
G87624 LOC103358853,LOC104921025 other downstream 1994309 23738982 ~ 23741190 (-)
ptprjb.1 NA other upstream 917513 26653636 ~ 26692244 (-)
G88249 mthfs other upstream 1277114 27013237 ~ 27014411 (-)
zgc:153031 LOC100703984,LOC102237950,LOC106523206,LOC105917737 other upstream 1487839 27223962 ~ 27229372 (-)
G88379 panx2 other upstream 1618849 27354972 ~ 27355776 (-)
LOC120564276 LOC103371718,LOC104949276,LOC102797857,LOC100696892 other upstream 1887867 27623990 ~ 27650062 (-)

Expression


Co-expression Network