G93335 (kifap3)


Basic Information

Item Value
gene id G93335
gene name kifap3
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053120.1
NCBI id CM020917.1
chromosome length 41568296
location 4798411 ~ 4805232 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU125920
GCACTGTAGAACAGGTCGGGCCTCTCCAGGATGTCTCTGTCCCCGATGAAGGATTCTCCGTCCTCCCCGAACACAAAGGGCTCTCCCTCTTCATCCATCAGGCGGTTCTCCACCATCTCCAGCCACTGACCGTTGTACCAGCGGAACTTCTCATTCTGGATCTTCTTTCCCCACTCCTCGTCGTATTCGGCGATGATGTCCAGCGTGTTGTGGCAGACTTTGCGGATCTCTGCGTTGTTATCGTGCATCAGGTCGATGAGGTACGCTGGGGCTTGCGTGTCTTTGACGATGACATCCCTGGTAGCTTTGTGAAAGACCATCTGGTAGAAGACGTACACAATCTGACACACAAACTC

Function

symbol description
kifap3 Enables kinesin binding activity and protein phosphatase binding activity. Predicted to be involved in cilium organization and microtubule-based movement. Predicted to act upstream of or within several processes, including negative regulation of apoptotic process; negative regulation of cell population proliferation; and positive regulation of calcium-dependent cell-cell adhesion. Located in centrosome and condensed nuclear chromosome. Part of kinesin II complex. Colocalizes with spindle microtubule.

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU125920 True 356 lncRNA 0.54 3 4798411 4805232

Neighbor

gene id symbol gene type direction distance location
niban1a LOC104958505 coding upstream 14260 4714655 ~ 4784151 (+)
LOC120565686 LOC104953734 coding upstream 136226 4657761 ~ 4662185 (+)
LOC120565681 NA coding upstream 195258 4599472 ~ 4603153 (+)
LOC120565674 NA coding upstream 278818 4515052 ~ 4519593 (+)
LOC120565669 NA coding upstream 354887 4439340 ~ 4443524 (+)
mettl11b mettl11b coding downstream 47716 4852948 ~ 4873356 (+)
gorab gorab coding downstream 129529 4934761 ~ 4946307 (+)
prrx1b prrx1 coding downstream 161327 4966559 ~ 5000440 (+)
LOC120566192 NA coding downstream 219278 5024510 ~ 5201875 (+)
mast2 mast2,LOC102294889,LOC102799744 coding downstream 405938 5211170 ~ 5486885 (+)
G93327 NA non-coding upstream 12467 4711274 ~ 4785944 (+)
G93323 NA non-coding upstream 39351 4692723 ~ 4759060 (+)
G93332 NA non-coding upstream 48242 4745280 ~ 4750169 (+)
G93308 NA non-coding upstream 191618 4592376 ~ 4606793 (+)
G93286 NA non-coding upstream 292437 4500549 ~ 4505974 (+)
G93345 NA non-coding downstream 88086 4893318 ~ 4893706 (+)
G93348 NA non-coding downstream 128839 4934071 ~ 4993591 (+)
G93349 NA non-coding downstream 133916 4939148 ~ 4939410 (+)
G93350 NA non-coding downstream 138413 4943645 ~ 4943947 (+)
G93431 NA non-coding downstream 253374 5058606 ~ 5100316 (+)
trmt1l trmt1l other upstream 85178 4685224 ~ 4713233 (+)
LOC120565391 NA other upstream 484896 4284755 ~ 4313515 (+)
G93150 NA other upstream 580585 4174602 ~ 4217826 (+)
frem1b LOC100693369,LOC101486624,LOC102206675,LOC102294239 other upstream 974629 3714919 ~ 3823782 (+)
G92848 NA other upstream 1191586 3600978 ~ 3606825 (+)
G93613 NA other downstream 1230137 6035369 ~ 6051520 (+)
G93638 NA other downstream 1396853 6202085 ~ 6214017 (+)
rhpn1 rhpn1 other downstream 1549660 6354892 ~ 6381598 (+)
G93938 NA other downstream 2544578 7349810 ~ 7350587 (+)
LOC120565294 pycrl other downstream 3073687 7878919 ~ 7890177 (+)

Expression


Co-expression Network