G93985


Basic Information

Item Value
gene id G93985
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053120.1
NCBI id CM020917.1
chromosome length 41568296
location 7524990 ~ 7525343 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU126801
TCGTGTCCTGTGGGCCAAGGCTCATTTAAAATGGACTATTTCAAAGTGTAATAGTGTTCTATGGTCAGACGAGTCCAAATTTGACATTCTTGTTGGAAATCACGGACGCCATGTCCTCCGGGCTAAAGAGGAAGGAGACCTTCCAGCATGTTATCAGCGTTCAGTTCAAAAGCCAGCATCTCTGATGGTATGGGGGTGCATAAGTGCATACGGTATGGGCAGCTTGCATGTTTTGGAAGGCTCTGTGAATGCTGAAAGGTATATAAAGGTTTTAGAGCAACATATGCTTCCCTCCAAACGACGTCTATTTCATGGAAGGCCTTGTATATTTCAGCAGGACAATGCAAACAGCAT

Function

GO:

id name namespace
GO:0006508 proteolysis biological_process
GO:0005576 extracellular region cellular_component

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05133 Pertussis
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus

RNA

RNA id representative length rna type GC content exon number start site end site
TU126801 True 354 lncRNA 0.45 1 7524990 7525343

Neighbor

gene id symbol gene type direction distance location
LOC120566212 irf4,LOC104941070 coding upstream 101170 7415441 ~ 7423820 (+)
LOC120566053 dusp22 coding upstream 111298 7398138 ~ 7413692 (+)
LOC120565797 slc22a23,LOC102794535 coding upstream 145646 7353848 ~ 7379344 (+)
LOC120565613 NA coding upstream 239231 7263547 ~ 7285759 (+)
igfbp3 LOC103358919 coding upstream 397718 7108149 ~ 7127272 (+)
foxq1b foxq1,LOC104946962 coding downstream 54849 7580192 ~ 7581837 (+)
foxf2b foxf2,LOC102792585 coding downstream 60798 7586141 ~ 7590299 (+)
LOC120564954 foxc1,LOC104932399,LOC104963658 coding downstream 78117 7603460 ~ 7605630 (+)
LOC120565646 LOC103354728,LOC102290039,LOC107394705 coding downstream 336871 7862214 ~ 7867728 (+)
LOC120565295 tsta3,LOC104953080 coding downstream 343248 7868591 ~ 7873986 (+)
LOC120566054 NA non-coding upstream 129712 7394373 ~ 7395278 (+)
G93933 NA non-coding upstream 197304 7327171 ~ 7327686 (+)
G93932 LOC103399850 non-coding upstream 201564 7322066 ~ 7323426 (+)
G93931 NA non-coding upstream 203535 7318842 ~ 7321455 (+)
G93912 NA non-coding upstream 237837 7271936 ~ 7287153 (+)
G93986 NA non-coding downstream 31911 7557254 ~ 7615427 (+)
LOC120565893 NA non-coding downstream 366881 7892224 ~ 7895718 (+)
G94056 LOC104961454 non-coding downstream 428072 7953415 ~ 7955102 (+)
G94057 NA non-coding downstream 465945 7991288 ~ 7991555 (+)
G94059 NA non-coding downstream 577650 8102993 ~ 8103363 (+)
G93938 NA other upstream 174403 7349810 ~ 7350587 (+)
rhpn1 rhpn1 other upstream 1143392 6354892 ~ 6381598 (+)
G93638 NA other upstream 1310973 6202085 ~ 6214017 (+)
G93613 NA other upstream 1473470 6035369 ~ 6051520 (+)
trmt1l trmt1l other upstream 2811757 4685224 ~ 4713233 (+)
LOC120565294 pycrl other downstream 353576 7878919 ~ 7890177 (+)
LOC120565614 NA other downstream 370802 7896145 ~ 7905247 (+)
G94073 rgs5,LOC107393027,LOC104951458,LOC100708109,LOC105932873 other downstream 712027 8237370 ~ 8286436 (+)
G94199 LOC103367571,LOC102312400,LOC100710958,LOC101467655 other downstream 1621819 9147162 ~ 9168877 (+)
LOC120566011 NA other downstream 1859162 9384505 ~ 9543535 (+)

Expression


Co-expression Network