G94232


Basic Information

Item Value
gene id G94232
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053120.1
NCBI id CM020917.1
chromosome length 41568296
location 9484003 ~ 9485965 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU127117
AATTACAGCCATCAAGAAAGGGTTGAATTCATGTGTCAAAGATACTACACCATGGAGGGTGGGCCTTACAGAACCTGCATCAGCGGTGAATGGACCGGACAGATGAGATGCCTCAAACCCTGTATTGTGAATGAAGACCTCTATAGACAACACAACATTACTATAAAATCTAGTGACAGTACATTTTTCTCTCATGATGAAATAATTGAGTTCAGGTGTGCCAGAGGAGTACCAGTCGGTGCAGTGGCAATGCGTCAGAGGTGTAATGGGGGTGTGATTCTCCTGCCTACCTGCCAGTGAGAGTCATCTGAAAGTAATCTACAG

Function

GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus

RNA

RNA id representative length rna type GC content exon number start site end site
TU127117 True 324 lncRNA 0.45 2 9484003 9485965

Neighbor

gene id symbol gene type direction distance location
LOC120566014 NA coding upstream 10629 9462445 ~ 9473374 (+)
LOC120564889 rgs2,LOC103367537 coding upstream 400146 9080859 ~ 9083857 (+)
LOC120566074 LOC104935955,LOC103367504 coding upstream 413327 9067178 ~ 9070676 (+)
LOC120564878 NA coding upstream 421967 9057341 ~ 9062036 (+)
LOC120564973 LOC103367494,LOC104965670,LOC104935957 coding upstream 450323 9021517 ~ 9033680 (+)
trnah-gug_12 NA coding downstream 86333 9572298 ~ 9572369 (+)
depdc1a depdc1 coding downstream 89293 9575258 ~ 9587669 (+)
LOC120566020 LOC103374322,LOC104940880,LOC103131468,LOC106964853 coding downstream 103191 9589156 ~ 9603575 (+)
fnbp1l fnbp1l,LOC102783810 coding downstream 128830 9614795 ~ 9671788 (+)
hps3 hps3 coding downstream 280111 9766076 ~ 9785140 (+)
LOC120566015 NA non-coding upstream 46382 9434721 ~ 9437621 (+)
G94201 NA non-coding upstream 314246 9169319 ~ 9169757 (+)
G94192 uchl5 non-coding upstream 387711 9089828 ~ 9096292 (+)
G94169 NA non-coding upstream 482297 9001456 ~ 9001706 (+)
G94167 NA non-coding upstream 483543 9000163 ~ 9000460 (+)
LOC120566016 NA non-coding downstream 8016 9493981 ~ 9495357 (+)
G94231 NA non-coding downstream 54572 9540537 ~ 9541059 (+)
G94238 NA non-coding downstream 61749 9547714 ~ 9551691 (+)
G94259 NA non-coding downstream 176167 9662132 ~ 9679737 (+)
G94266 bcar3,LOC102779191,LOC102207586,LOC101480816 non-coding downstream 205964 9691929 ~ 9693033 (+)
G94199 LOC103367571,LOC102312400,LOC100710958,LOC101467655 other upstream 315126 9147162 ~ 9168877 (+)
G94073 rgs5,LOC107393027,LOC104951458,LOC100708109,LOC105932873 other upstream 1197567 8237370 ~ 8286436 (+)
LOC120565614 NA other upstream 1578756 7896145 ~ 7905247 (+)
LOC120565294 pycrl other upstream 1593826 7878919 ~ 7890177 (+)
G93938 NA other upstream 2133416 7349810 ~ 7350587 (+)
G94239 NA other downstream 66331 9552296 ~ 9557568 (+)
G94281 NA other downstream 331656 9817621 ~ 9879198 (+)
LOC120565620 NA other downstream 358306 9844271 ~ 9846275 (+)
G94376 NA other downstream 416320 9902285 ~ 9903189 (+)
ttc14 ttc14 other downstream 447648 9933613 ~ 9948237 (+)

Expression


Co-expression Network