XLOC_004676 (zgc:163057)


Basic Information

Item Value
gene id XLOC_004676
gene name zgc:163057
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007123.7
NCBI id CM002896.2
chromosome length 49182954
location 20336070 ~ 20337274 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00009261
AGTCACGTGATGAACTCATTGACCGGTGAGGTGAAGAGAGCGACCGACGGGAACGACAACAGTTCGGTTAACCGCTCTCTTCTGTTTTTGCACTATTTATCGAGTTTATGGTTAATTATGCGGCCAAGTCGTCGATCTATTTGCGTGTTTTTAACTGAAGCTAATTTAATTTAACCTATTTATTCAGCTGTGTTTGGTAGTAGATCAATAAGCTATATTTTAGCAATATTTAACTGCATAATAATGCTCTCGAGTGCCGAAAAAGAGCTGATTGCAGAAATATGGGACAAAATGACTCCAGTGGCGGAAGAAATTGGATCTGAAGCTCTTTTAAGGATGTTCACAACGTTCCCCAAAACAAAGACATACTTCTCTCATCTAAATATCAGCGCTAATTCAGAGCATTTGCGCTCCCACGGAAAGAAAATCGTCGAGGCTCTGGCCGAGGGTGCGAAGAACATAAGCACACTTACTACAACGTTGGCACCACTTAGCAGGTTCCATGCCTACCAACTGCGAATACATCCTACAAACTTCAAGCTTTTCAATCATTGCATCCTTGTGACGTTAGCCTGCAGAATGGGTGACGACTTCACTCCAGTGGTGCACGCGGCGATAGACAAGTTTCTGTCGGCATTCTCAGCTGTTCTAGCCGAGAAGTTCCGATGAAGAGCCCTCAGAGGAAGGACGGAATGGTTCTGCCAGATATTATCTTTATCAATGTATATGCTAGCTTATTAAATAAACTGATAAATACTCA

Function

symbol description
zgc:163057 Predicted to enable several functions, including heme binding activity; oxygen binding activity; and oxygen carrier activity. Predicted to contribute to haptoglobin binding activity and peroxidase activity. Predicted to be involved in hydrogen peroxide catabolic process. Predicted to act upstream of or within oxygen transport. Predicted to be part of haptoglobin-hemoglobin complex and hemoglobin complex. Orthologous to human HBM (hemoglobin subunit mu).

GO:

id name namespace
GO:0042744 hydrogen peroxide catabolic process biological_process
GO:0015671 oxygen transport biological_process
GO:0031838 haptoglobin-hemoglobin complex cellular_component
GO:0005833 hemoglobin complex cellular_component
GO:0019825 oxygen binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0004601 peroxidase activity molecular_function
GO:0043177 organic acid binding molecular_function
GO:0005344 oxygen carrier activity molecular_function
GO:0031720 haptoglobin binding molecular_function
GO:0020037 heme binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070410-131 Predicted to enable several functions, including heme binding activity; oxygen binding activity; and oxygen carrier activity. Predicted to contribute to haptoglobin binding activity and peroxidase activity. Predicted to be involved in hydrogen peroxide catabolic process. Predicted to act upstream of or within oxygen transport. Predicted to be part of haptoglobin-hemoglobin complex and hemoglobin complex. Orthologous to human HBM (hemoglobin subunit mu).

Ensembl:

ensembl_id ENSDARG00000045144

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00009261 True 760 mRNA 0.43 3 20336070 20337274

Neighbor

gene id symbol gene type direction distance location
XLOC_004675 NA coding upstream 70605 20263585 ~ 20265465 (+)
XLOC_004674 mgrn1a coding upstream 179056 20122256 ~ 20157014 (+)
XLOC_004673 mrtfba coding upstream 290969 19976400 ~ 20045101 (+)
XLOC_004672 ercc4 coding upstream 360697 19958845 ~ 19975373 (+)
XLOC_004671 cpped1 coding upstream 403447 19866865 ~ 19932623 (+)
XLOC_004677 hbae5 coding downstream 5177 20342451 ~ 20353541 (+)
XLOC_004678 arhgap17a coding downstream 75019 20412293 ~ 20482061 (+)
XLOC_004679 NA coding downstream 154345 20491619 ~ 20504801 (+)
XLOC_004680 si:zfos-754c12.2 coding downstream 168923 20506197 ~ 20508359 (+)
XLOC_004681 gna13a coding downstream 214916 20552190 ~ 20564678 (+)
XLOC_004670 NA non-coding upstream 876785 19458809 ~ 19459285 (+)
XLOC_004667 BX649366.2 non-coding upstream 947797 19388143 ~ 19388273 (+)
XLOC_004660 NA non-coding upstream 1064914 19267759 ~ 19271156 (+)
XLOC_004648 NA non-coding upstream 1468095 18861278 ~ 18867975 (+)
XLOC_004689 NA non-coding downstream 469623 20806897 ~ 21106987 (+)
XLOC_004691 FO704814.1 non-coding downstream 1100072 21437346 ~ 21437458 (+)
XLOC_004694 NA non-coding downstream 1420543 21757817 ~ 21799396 (+)
XLOC_004695 NA non-coding downstream 1680672 22017946 ~ 22019770 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000063_01682341_01683245 NA coding CI01000063 null 1682279 ~ 1683245 (-)