G94684 (lrrc7)


Basic Information

Item Value
gene id G94684
gene name lrrc7
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053120.1
NCBI id CM020917.1
chromosome length 41568296
location 11118278 ~ 11118503 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU127724
GGGGTTGTAGTTGTGGTCGAAGTGGTAGGCCTTATGTGGGATGGCAGGTTTTTGGTTCTGTCCCGACTGGTTCTGGTTGCTGCCTCCGTGTCCTGGGAACATCAGCTCATCATCCAACATGGGGACAGACTGTGACCGTGACATGTTGGTCTGCTCCATAGAACCGGGCAAATCTTGACGGTCCAAACTAGTCTGTTGCTCAATGGATGAACTGTAGGTGTCCACA

Function

symbol description
lrrc7 Predicted to enable signaling receptor binding activity. Predicted to be involved in several processes, including cellular response to tumor necrosis factor; negative regulation of NF-kappaB transcription factor activity; and positive regulation of Ras protein signal transduction. Predicted to be active in basolateral plasma membrane. Orthologous to human LRRC7 (leucine rich repeat containing 7).

NR:

description
PREDICTED: leucine-rich repeat-containing protein 7

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU127724 True 226 lncRNA 0.52 1 11118278 11118503

Neighbor

gene id symbol gene type direction distance location
LOC120565506 NA coding upstream 11080 11105141 ~ 11107198 (+)
LOC120566056 LOC103374891,LOC100702684,LOC101467020,LOC102305063 coding upstream 358349 10748929 ~ 10759929 (+)
LOC120566058 LOC103374891,LOC102305063,LOC100702684,LOC101467020 coding upstream 384317 10722902 ~ 10733961 (+)
tm4sf18 LOC100702951,LOC102305373,LOC101466751,LOC102228636,LOC103155263,LOC104936000,LOC103374892,LOC105936905 coding upstream 403396 10696023 ~ 10714882 (+)
LOC120565966 LOC101466472,LOC102777579,LOC108238401,LOC101066382,LOC106527066 coding upstream 427192 10681539 ~ 10691086 (+)
ccdc17 NA coding downstream 104019 11222522 ~ 11237901 (+)
LOC120565497 LOC103370597 coding downstream 129931 11248434 ~ 11304093 (+)
trnam-cau_8 NA coding downstream 130072 11248575 ~ 11248647 (+)
LOC120566075 LOC101470345,LOC102300495,LOC102205443,LOC103370586 coding downstream 193235 11311738 ~ 11356871 (+)
LOC120565022 NA coding downstream 354853 11473356 ~ 11490038 (+)
G94683 lrrc7 non-coding upstream 594 11117331 ~ 11117684 (+)
G94682 NA non-coding upstream 1138 11116899 ~ 11117140 (+)
G94681 NA non-coding upstream 2247 11115704 ~ 11116031 (+)
G94680 lrrc7,LOC103129487,LOC106524106 non-coding upstream 3601 11114398 ~ 11114677 (+)
G94677 NA non-coding upstream 13756 11104221 ~ 11104522 (+)
G94685 NA non-coding downstream 127 11118630 ~ 11118841 (+)
G94686 NA non-coding downstream 887 11119390 ~ 11119881 (+)
G94687 lrrc7,LOC103129487 non-coding downstream 2966 11121469 ~ 11121684 (+)
G94688 LOC104952604 non-coding downstream 8253 11126756 ~ 11127020 (+)
G94690 NA non-coding downstream 57501 11176004 ~ 11176217 (+)
si:ch211-162e15.3 LOC103376230,LOC100712485,LOC108238459,LOC102795316,LOC102207055 other upstream 169962 10946932 ~ 10948316 (+)
G94598 NA other upstream 177034 10916925 ~ 10941244 (+)
atp11b atp11b other upstream 703452 10363462 ~ 10414826 (+)
LOC120565490 NA other upstream 958397 9985719 ~ 10159881 (+)
ttc14 ttc14 other upstream 1170041 9933613 ~ 9948237 (+)
LOC120565923 LOC103370579,LOC100695501,LOC102794561,LOC101470646,LOC102226407,LOC102291616 other downstream 241187 11359690 ~ 11458146 (+)
znhit6 znhit6,LOC102790327 other downstream 670632 11789135 ~ 11821882 (+)
lrp8 LOC103355569 other downstream 1043135 12161638 ~ 12443080 (+)
ror1 ror1 other downstream 1624302 12742805 ~ 12865842 (+)
raver2 raver2 other downstream 1887065 13005568 ~ 13100445 (+)

Expression


Co-expression Network