G99577


Basic Information

Item Value
gene id G99577
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053120.1
NCBI id CM020917.1
chromosome length 41568296
location 30884264 ~ 30885185 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU134279
cgaatataattggctgtaatgttttccattttggatgttgaagattaagaacaagactttcaaatgagttataatgtaatttaggtttaggagtaattagcaggcttgcatcaaagatggctgcaactccccctcctcggcctgagcctctaggaatttgagtattaatatggctgggaggagtggcttcatttagactaacatagtcttcatggcccagccaggtttcagtaagacaaaataaatcaattttattgtctgatatcaactcgtttaccagtactgctttagaagacagagatctaatatttaatagtccacatctaattttcctattttgttttattgcagtagttttaattccaattaggttgttaagtatagcgcatctttcgtttacctttgatttaaccgatctgagccgggggacagacaccgtgcttattagactatgagtgggcgactgctccaacggaagcacagaggggcgcgtagcactgcacctctgattactaatatcaaacttgggttgtcatggtttatgtctgataaactcgttcagactttttgatatgagagcggcaccgtcccaggtgggatgaatgccgtctctctcaatcagaccaggctttccccagaacgccctccagttattcacatagcccacatcattagctgggcaccaccccgacaaccagcggtggaaggatgacgtacggctgtacatttcatcattggtcaggtttggcaggggtccagagaaaactactgagtccgacattgtctttgcgtatgcacaaagtgactcaacattcattttagtgatctccgatttacgaccattaccacctacgtgaagtatgatcttactgtatttacggttcttttttgccagcagctttagatgggtttctatatcgcc

Function

GO: NA

KEGG:

id description
ko00514 Other types of O-glycan biosynthesis

RNA

RNA id representative length rna type GC content exon number start site end site
TU134279 True 922 lncRNA 0.43 1 30884264 30885185

Neighbor

gene id symbol gene type direction distance location
magoh magoh,mgn,LOC106560432,LOC107387361,LOC101074452,LOC107731141,LOC107549138 coding upstream 47637 30832801 ~ 30836627 (+)
uck2a uck2,LOC100698935,LOC102786757 coding upstream 54993 30824223 ~ 30829271 (+)
LOC120566104 pbx1,LOC104964292,LOC108272157,LOC103479586 coding upstream 89435 30727013 ~ 30794829 (+)
sec16b LOC104942848 coding upstream 325110 30541357 ~ 30559154 (+)
gng12b NA coding upstream 348391 30529968 ~ 30535873 (+)
akr1a1b akr1a1,LOC102789595 coding downstream 48723 30933908 ~ 30945625 (+)
uhmk1 uhmk1 coding downstream 518588 31403773 ~ 31513916 (+)
mcf2l2 NA coding downstream 898041 31783226 ~ 32159445 (+)
ect2 ect2,LOC102798372 coding downstream 1335848 32221033 ~ 32411447 (+)
si:ch211-51h4.2 LOC102206538,LOC102309665,LOC102076398 coding downstream 2887261 33772446 ~ 33875096 (+)
G99576 NA non-coding upstream 998 30882378 ~ 30883266 (+)
G99573 NA non-coding upstream 15013 30868989 ~ 30869251 (+)
G99567 NA non-coding upstream 17812 30864900 ~ 30866452 (+)
G99530 NA non-coding upstream 163404 30720621 ~ 30720860 (+)
G99528 NA non-coding upstream 190259 30693639 ~ 30694005 (+)
G99578 NA non-coding downstream 500 30885685 ~ 30885971 (+)
G99579 NA non-coding downstream 2867 30888052 ~ 30888603 (+)
G99591 NA non-coding downstream 12978 30898163 ~ 30898386 (+)
LOC120566117 NA non-coding downstream 39094 30924279 ~ 30925498 (+)
G99597 NA non-coding downstream 60603 30945788 ~ 30946089 (+)
G99545 NA other upstream 73028 30810518 ~ 30811236 (+)
si:ch73-389b16.1 ccdc18 other upstream 454973 30427503 ~ 30429291 (+)
G99297 NA other upstream 1219174 29663633 ~ 29665090 (+)
ralgps2 ralgps2 other upstream 2018777 28775375 ~ 28865487 (+)
LOC120565530 LOC100702602,LOC101154857,LOC107096371,LOC105928898,LOC101076602,LOC108230771 other upstream 2109711 28772362 ~ 28774553 (+)
slc1a7b LOC103368436,LOC102788729,LOC102303821 other downstream 210696 31095881 ~ 31302827 (+)
LOC120564930 NA other downstream 728704 31613889 ~ 31643446 (+)
G99791 NA other downstream 737513 31622698 ~ 31625796 (+)
G99803 NA other downstream 744631 31629816 ~ 31631501 (+)
LOC120565823 NA other downstream 876807 31761992 ~ 31767539 (+)

Expression


Co-expression Network