G100174 (calr3)


Basic Information

Item Value
gene id G100174
gene name calr3
gene type unknown
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053120.1
NCBI id CM020917.1
chromosome length 41568296
location 34504643 ~ 34507552 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU134982
AGTCAGGGTTGTCAATCTTCTTGGGACTCCACTCGCCTTGTACTCGGGGTTGGTGATCATGGGAGGTTCCCACTCTCCGTCCATGTCCTCGTCCCAGTCACTAGGCTTCTTGGCATCAGGGTCGGGGATGGTCTCTGGCTTGTCCCATTCCTCGGGCTTGGTGTCGGTGGGGTCGTCGATCTTGGCCCTGTCGTCCCAGTCGCTGGGCTTCTTGGCCTCTGGGTCCTTGATCTTCTTTAGGGGCAGCATGTCCCAGTCGTCCTCCAGAGAGCCGGACTCCACCTTCTCGTTGTTGATCTTCACCTCGTATGTCTGGTCTGGATTCAGGATCAGCGTGTACAGGTTGGTCAGCTC

Function

symbol description
calr3 Predicted to enable several functions, including calcium ion binding activity; protein folding chaperone; and unfolded protein binding activity. Predicted to be involved in protein folding and ubiquitin-dependent ERAD pathway. Located in endoplasmic reticulum lumen and nuclear envelope.

NR:

description
PREDICTED: calreticulin-3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU134982 True 354 TUCP 0.58 3 34504643 34507552

Neighbor

gene id symbol gene type direction distance location
LOC120565866 LOC105938272,LOC105937414,LOC105938273 coding upstream 47687 34454381 ~ 34456956 (+)
LOC120565861 LOC103354068,LOC104966713 coding upstream 120616 34380747 ~ 34384027 (+)
LOC120565538 cherp coding upstream 411068 34066115 ~ 34093575 (+)
si:ch211-247n2.1 LOC102307905,LOC103372256,LOC102782276,LOC101477182,LOC102211467 coding upstream 441068 34031890 ~ 34063575 (+)
si:ch211-51h4.2 LOC102206538,LOC102309665,LOC102076398 coding upstream 629547 33772446 ~ 33875096 (+)
arhgap39 arhgap39 coding downstream 21016 34528568 ~ 34661669 (+)
hyi hyi coding downstream 960459 35468011 ~ 35477553 (+)
ddx10 ddx10 coding downstream 1165808 35673360 ~ 35678429 (+)
LOC120566096 NA coding downstream 1192273 35699825 ~ 35737010 (+)
LOC120565108 NA coding downstream 1730300 36237852 ~ 36284806 (+)
G100161 NA non-coding upstream 54128 34450281 ~ 34450515 (+)
G100148 NA non-coding upstream 200297 34304090 ~ 34304346 (+)
LOC120565927 NA non-coding upstream 282512 34220623 ~ 34222131 (+)
G100043 NA non-coding upstream 1299897 33204180 ~ 33204746 (+)
G100028 NA non-coding upstream 1424802 33078937 ~ 33079841 (+)
G100199 lrrc41 non-coding downstream 158930 34666482 ~ 34677930 (+)
G100215 NA non-coding downstream 229955 34737507 ~ 34793890 (+)
G100257 NA non-coding downstream 341651 34849203 ~ 34849492 (+)
G100259 NA non-coding downstream 344761 34852313 ~ 34852518 (+)
G100279 NA non-coding downstream 366790 34874342 ~ 34877423 (+)
G100087 NA other upstream 626312 33875209 ~ 33878331 (+)
LOC120566032 naaladl2,LOC102797677,LOC101487368 other upstream 741724 33243213 ~ 33762919 (+)
nlgn1 nlgn1,LOC102797975 other upstream 1626010 32436847 ~ 32878633 (+)
LOC120565823 NA other upstream 2737104 31761992 ~ 31767539 (+)
G99803 NA other upstream 2873142 31629816 ~ 31631501 (+)
dsg2.1 NA other downstream 1707912 36215464 ~ 36234599 (+)
G100568 lmnb2 other downstream 1965986 36473538 ~ 36475195 (+)
smim24 NA other downstream 1987932 36495484 ~ 36534582 (+)
sass6 sass6,LOC102776185 other downstream 2088489 36596041 ~ 36611746 (+)
G100671 NA other downstream 2187885 36695437 ~ 36698869 (+)

Expression


Co-expression Network