G102189


Basic Information

Item Value
gene id G102189
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053120.1
NCBI id CM020917.1
chromosome length 41568296
location 41511984 ~ 41512370 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU137567
tactttgttacattctaccactgcattttggccctataaatagcgatcaatcaccaaataacgcaagatttaatcagtttaattgctgatgtaaattgcagtgttagtgttttttttgcatactatgatattttttttcaacaaatgatcagaaatacattacagtacaatactatcattgtaaacgactgtagaattaaataaaatgcagtaagcaatcatttggagcaaattgtcatcactcaaatgtgcgtaagagtgcttttcagtgttcgtagattttgttcttagctaagaacaaatccaagttaagaaaacattagtgaatgccagaatcttcgtaaaaagttcgtaagaagggtttaagaacacatttcttcgtaagaa

Function

GO: NA

KEGG:

id description
ko04141 Protein processing in endoplasmic reticulum
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus
ko05020 Prion disease

RNA

RNA id representative length rna type GC content exon number start site end site
TU137567 True 387 lncRNA 0.31 1 41511984 41512370

Neighbor

gene id symbol gene type direction distance location
im:7152348 NA coding upstream 284328 41226610 ~ 41227656 (+)
trnap-ugg_3 NA coding upstream 286279 41225634 ~ 41225705 (+)
trnap-cgg_3 NA coding upstream 286822 41225091 ~ 41225162 (+)
bcl6aa bcl6 coding upstream 406236 41086373 ~ 41105748 (+)
zbtb11 zbtb11 coding upstream 764607 40737734 ~ 40747377 (+)
zgc:103559 LOC104941656,LOC108241179 coding downstream 15031 41527401 ~ 41533655 (+)
G102074 NA non-coding upstream 243328 41209660 ~ 41268656 (+)
G102081 NA non-coding upstream 277582 41231667 ~ 41234402 (+)
G102022 LOC106527457,LOC108240210,LOC103354232,LOC107088662 non-coding upstream 354944 41156552 ~ 41157040 (+)
G102021 NA non-coding upstream 355517 41154922 ~ 41156467 (+)
G102006 NA non-coding upstream 397749 41111573 ~ 41114235 (+)
G102165 NA other upstream 58678 41452674 ~ 41453306 (+)
atp10a atp10a other upstream 952089 40515093 ~ 40559895 (+)
LOC120565298 cdkl5,LOC103356958 other upstream 1771707 39693912 ~ 39740277 (+)
reps2 reps2,LOC102792668 other upstream 1919222 39561061 ~ 39592762 (+)
LOC120565708 LOC103369944,LOC100698021,LOC101482931,LOC102791229,LOC102291415,LOC102212992 other upstream 2047534 39454120 ~ 39464450 (+)

Expression


Co-expression Network