G104962 (hspa9)


Basic Information

Item Value
gene id G104962
gene name hspa9
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053121.1
NCBI id CM020918.1
chromosome length 40300294
location 14778207 ~ 14778741 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU140926
TGCTCTCGGCCCGTCCCCTTGTCCTTGGCCGAGACGTGGACGATGCCGTTGGCGTCAATGTCAAAGGTGACCTCAACCTGAGGGACGCCGCGGGGGGCAGGGGGGATTCCCACCAGAGTGAACTGACCCAGCACCTTGTTGTCTGCTGCCATCTCCCGCTCTCCCTGACACACCTTGATCTCCACCTGCGTCTGTCCGTCCGCCGCCGTGGAGAACACCTGGCTCTTCTTGGTGGGAATGGTGGTGTTCCTGTTGATGAGTTTGGTGAAGACTCCGCCCAGGGTCTCGATACCCAGAGACAGAGGTGTGACATCCAACAGCAGAACATCAGTCACATCACCGGCCAAAACTCCACCCTGGATGGCTGCTCCTATGGCAACGGCCTCGTCAGGGTTGACGGACTTGCTGGGAGCGCGGCCGAACAGGTCCTGAACAGTTTGTTGCACCT

Function

symbol description
hspa9 Predicted to enable several functions, including ATP binding activity; ATP hydrolysis activity; and misfolded protein binding activity. Acts upstream of or within fin regeneration and hemopoiesis. Predicted to be active in mitochondrion. Is expressed in several structures, including digestive system; eye; midbrain; musculature system; and segmental plate. Human ortholog(s) of this gene implicated in Parkinson's disease and autosomal dominant sideroblastic anemia 4. Orthologous to human HSPA9 (heat shock protein family A (Hsp70) member 9).

NR:

description
PREDICTED: stress-70 protein, mitochondrial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU140926 True 448 lncRNA 0.60 2 14778207 14778741

Neighbor

gene id symbol gene type direction distance location
rab33ba LOC103374601,LOC106911658 coding downstream 12012 14761945 ~ 14766195 (-)
trnaa-ugc_8 NA coding downstream 74104 14704032 ~ 14704103 (-)
mmp17b LOC104951499,LOC101483571 coding downstream 80927 14685137 ~ 14697280 (-)
LOC120566517 NA coding downstream 105892 14639653 ~ 14672315 (-)
trappc11 trappc11 coding downstream 161622 14599723 ~ 14616585 (-)
gpr151 gpr151 coding upstream 50579 14829320 ~ 14833836 (-)
ppp2r2ba ppp2r2b,LOC107086445,LOC104946885,LOC100708080 coding upstream 55313 14834054 ~ 14882816 (-)
nkx2.5 nkx2-5 coding upstream 119567 14898308 ~ 14901290 (-)
drd1a drd1,LOC103470866,LOC103144507,LOC106953475 coding upstream 250167 15028908 ~ 15032268 (-)
nek12 NA coding upstream 271395 15050136 ~ 15053250 (-)
G104924 NA non-coding downstream 140762 14635107 ~ 14637445 (-)
G104867 NA non-coding downstream 396145 14381645 ~ 14382062 (-)
G104865 hvcn1 non-coding downstream 404762 14369159 ~ 14373445 (-)
G104825 hars,LOC103363215,LOC101173848 non-coding downstream 640300 14131340 ~ 14137907 (-)
G104822 NA non-coding downstream 648616 14057501 ~ 14129591 (-)
G104999 NA non-coding upstream 105118 14883859 ~ 14888207 (-)
G105001 NA non-coding upstream 111852 14890593 ~ 14891511 (-)
LOC120567075 NA non-coding upstream 169652 14948393 ~ 14953055 (-)
G105040 NA non-coding upstream 246275 15025016 ~ 15025409 (-)
G105049 NA non-coding upstream 249609 15028350 ~ 15028866 (-)
LOC120567441 LOC100697283,LOC102197909,LOC102314576 other downstream 38714 14735192 ~ 14739493 (-)
uvssa uvssa,LOC104961899,LOC106533076 other downstream 204714 14537100 ~ 14573493 (-)
G104837 NA other downstream 522166 14150492 ~ 14256041 (-)
G104656 NA other downstream 2634463 12142700 ~ 12143744 (-)
G104610 immt,LOC102797104 other downstream 2785529 11964979 ~ 11992678 (-)
rnf44 rnf44 other upstream 310663 15089404 ~ 15108598 (-)
G105086 NA other upstream 354789 15133530 ~ 15134736 (-)
tspan17 tspan17,LOC103361971 other upstream 819602 15598343 ~ 15619108 (-)
hnrnph1 hnrnph1,LOC102791917 other upstream 1087319 15866060 ~ 15871949 (-)
unc5a unc5a,LOC102788949 other upstream 1181456 15960197 ~ 16103794 (-)

Expression


Co-expression Network