G105243 (LOC103365697,LOC106906325)


Basic Information

Item Value
gene id G105243
gene name LOC103365697,LOC106906325
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053121.1
NCBI id CM020918.1
chromosome length 40300294
location 15890157 ~ 15892250 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU141318
CCTCGTGGCCTTCTCTAGCCGCCTCCATCAGAGGTGTGTAGCCTTCATCATTAAACCTCCTCCAAATTGGCTCCTCTCTCGATGAGCAAGGCTGCCAGCTCCACGTGGCCTCCACAGGCTGCAAGAGTGAGGGGCGACTCAAAGGAATCGGCTGGCATGTTGACCTGCGCACCGCTGTCCAACAGCAGCCGTGCCACCTCCACATGGCCGTCCTGGGACATGCACGCTTCCATCAGTGCCGTGTGCATCTCATCCGTTTTATGTTCCTGGTCTGCTCCGGCCTCCAACAGAAAACGCACCATGTCTAAGTGACC

Function

NR:

description
PREDICTED: ankyrin repeat and KH domain-containing protein 1-like isoform X5

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU141318 True 314 lncRNA 0.58 3 15890157 15892250

Neighbor

gene id symbol gene type direction distance location
hbegfa LOC104968122 coding downstream 36121 15850494 ~ 15854036 (-)
rmnd5b rmnd5b,LOC103391242 coding downstream 98605 15783802 ~ 15791552 (-)
anxa6 anxa6,LOC102795126 coding downstream 160838 15717241 ~ 15729319 (-)
tnip1 tnip1,LOC103376067 coding downstream 174197 15698337 ~ 15715960 (-)
dctn4 dctn4 coding downstream 201339 15671635 ~ 15688818 (-)
cltb cltb,LOC103471122 coding upstream 22630 15914880 ~ 15919202 (-)
dok3 NA coding upstream 386065 16278315 ~ 16286986 (-)
LOC120567264 ddx41 coding upstream 394831 16287081 ~ 16297362 (-)
fam193b fam193b coding upstream 406570 16298820 ~ 16309416 (-)
prelid1a prelid1 coding upstream 424361 16316611 ~ 16323377 (-)
G105241 NA non-coding downstream 1089 15880363 ~ 15889068 (-)
G105230 NA non-coding downstream 61666 15828291 ~ 15828491 (-)
G105217 LOC103376071,LOC104959352 non-coding downstream 135140 15751454 ~ 15755017 (-)
G105149 NA non-coding downstream 320077 15569818 ~ 15570080 (-)
G105147 NA non-coding downstream 360898 15527066 ~ 15529259 (-)
G105247 NA non-coding upstream 4007 15896257 ~ 15896732 (-)
G105253 NA non-coding upstream 10119 15902369 ~ 15904937 (-)
G105279 NA non-coding upstream 36367 15928617 ~ 15958760 (-)
G105289 NA non-coding upstream 66869 15959119 ~ 15960179 (-)
G105292 NA non-coding upstream 163333 16055583 ~ 16056028 (-)
hnrnph1 hnrnph1,LOC102791917 other downstream 18208 15866060 ~ 15871949 (-)
tspan17 tspan17,LOC103361971 other downstream 271049 15598343 ~ 15619108 (-)
G105086 NA other downstream 755421 15133530 ~ 15134736 (-)
rnf44 rnf44 other downstream 781559 15089404 ~ 15108598 (-)
LOC120567441 LOC100697283,LOC102197909,LOC102314576 other downstream 1150664 14735192 ~ 14739493 (-)
unc5a unc5a,LOC102788949 other upstream 67947 15960197 ~ 16103794 (-)
gria3b LOC107394330,LOC106515969,LOC108242060,LOC101171999,LOC103357241,LOC104923180,LOC100695922,LOC102783061,LOC105925698,LOC107093457 other upstream 632106 16524356 ~ 16674855 (-)
rab9b rab9b,LOC103391151,LOC102204615,LOC100697336,LOC108436189,LOC103026314,LOC105912179 other upstream 1065393 16957643 ~ 16963536 (-)
tmsb1 NA other upstream 1249832 17142082 ~ 17151616 (-)
frmpd3 frmpd3 other upstream 1274646 17166896 ~ 17256932 (-)

Expression


Co-expression Network