G105292


Basic Information

Item Value
gene id G105292
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053121.1
NCBI id CM020918.1
chromosome length 40300294
location 16055583 ~ 16056028 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU141374
cttaggattgatgaatcccacgtcttcgtaactgaaagcgcgtgccagttgttcctaattagcataagaaaacgccccgcaaattcccatataaggacatgacacttcctgtgcacctcctgggagacaggttttcggagattgtcggagccgcggtggaggaagtactgaatctcagtacttaaataaaagtacaaataaccagagacatatttactttagtaaaagtataaggtgtccactaccacaaacaaggcctggcttttaaaaaaagttcctatcctaaccagcataaaacggaaatgtgttgttagaatcggaatgcggttggttttattcatggatgtattttattttctttaaccatgcaagtaagcaaataaagtgtgtgaagcagcgcaaatggggagatgtgaagaggtccagccaaataaataagatatgaa

Function

GO: NA

KEGG:

id description
ko04141 Protein processing in endoplasmic reticulum
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus
ko05020 Prion disease

RNA

RNA id representative length rna type GC content exon number start site end site
TU141374 True 446 lncRNA 0.40 1 16055583 16056028

Neighbor

gene id symbol gene type direction distance location
cltb cltb,LOC103471122 coding downstream 136381 15914880 ~ 15919202 (-)
hbegfa LOC104968122 coding downstream 201547 15850494 ~ 15854036 (-)
rmnd5b rmnd5b,LOC103391242 coding downstream 264031 15783802 ~ 15791552 (-)
anxa6 anxa6,LOC102795126 coding downstream 326264 15717241 ~ 15729319 (-)
tnip1 tnip1,LOC103376067 coding downstream 339623 15698337 ~ 15715960 (-)
dok3 NA coding upstream 222287 16278315 ~ 16286986 (-)
LOC120567264 ddx41 coding upstream 231053 16287081 ~ 16297362 (-)
fam193b fam193b coding upstream 242792 16298820 ~ 16309416 (-)
prelid1a prelid1 coding upstream 260583 16316611 ~ 16323377 (-)
npy7r LOC104967498,LOC104930063,LOC103356978 coding upstream 268545 16324573 ~ 16329511 (-)
G105289 NA non-coding downstream 95404 15959119 ~ 15960179 (-)
G105279 NA non-coding downstream 96823 15928617 ~ 15958760 (-)
G105253 NA non-coding downstream 150646 15902369 ~ 15904937 (-)
G105247 NA non-coding downstream 158851 15896257 ~ 15896732 (-)
G105243 LOC103365697,LOC106906325 non-coding downstream 163333 15890157 ~ 15892250 (-)
G105331 NA non-coding upstream 207203 16263231 ~ 16263863 (-)
G105332 NA non-coding upstream 208173 16264201 ~ 16264419 (-)
G105337 LOC103356977,LOC104930064,LOC102195804 non-coding upstream 278245 16334273 ~ 16339018 (-)
G105417 NA non-coding upstream 410420 16466448 ~ 16506278 (-)
LOC120567052 NA non-coding upstream 440429 16496457 ~ 16497322 (-)
hnrnph1 hnrnph1,LOC102791917 other downstream 183634 15866060 ~ 15871949 (-)
tspan17 tspan17,LOC103361971 other downstream 436475 15598343 ~ 15619108 (-)
G105086 NA other downstream 920847 15133530 ~ 15134736 (-)
rnf44 rnf44 other downstream 946985 15089404 ~ 15108598 (-)
LOC120567441 LOC100697283,LOC102197909,LOC102314576 other downstream 1316090 14735192 ~ 14739493 (-)
gria3b LOC107394330,LOC106515969,LOC108242060,LOC101171999,LOC103357241,LOC104923180,LOC100695922,LOC102783061,LOC105925698,LOC107093457 other upstream 468328 16524356 ~ 16674855 (-)
rab9b rab9b,LOC103391151,LOC102204615,LOC100697336,LOC108436189,LOC103026314,LOC105912179 other upstream 901615 16957643 ~ 16963536 (-)
tmsb1 NA other upstream 1086054 17142082 ~ 17151616 (-)
frmpd3 frmpd3 other upstream 1110868 17166896 ~ 17256932 (-)
nexmifb kiaa2022 other upstream 1466113 17522141 ~ 17577811 (-)

Expression


Co-expression Network