G105332


Basic Information

Item Value
gene id G105332
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053121.1
NCBI id CM020918.1
chromosome length 40300294
location 16264201 ~ 16264419 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU141418
tacagttttttccgattgctaaacgacagtgggcacaactggagtcacatgtacaaaactcaaactacagtctgcactaccaacagtcacctgagctaaacagttcacatcacctgcaaaactcatttaaagcaacacaactcttaacatacgtctcaaaacaggctcagtgcagccaaacactatgcacaagcctcactgagataacacgcactgtca

Function

GO: NA

KEGG:

id description
ko04080 Neuroactive ligand-receptor interaction
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption
ko05164 Influenza A

RNA

RNA id representative length rna type GC content exon number start site end site
TU141418 True 219 lncRNA 0.43 1 16264201 16264419

Neighbor

gene id symbol gene type direction distance location
cltb cltb,LOC103471122 coding downstream 344999 15914880 ~ 15919202 (-)
hbegfa LOC104968122 coding downstream 410165 15850494 ~ 15854036 (-)
rmnd5b rmnd5b,LOC103391242 coding downstream 472649 15783802 ~ 15791552 (-)
anxa6 anxa6,LOC102795126 coding downstream 534882 15717241 ~ 15729319 (-)
tnip1 tnip1,LOC103376067 coding downstream 548241 15698337 ~ 15715960 (-)
dok3 NA coding upstream 13896 16278315 ~ 16286986 (-)
LOC120567264 ddx41 coding upstream 22662 16287081 ~ 16297362 (-)
fam193b fam193b coding upstream 34401 16298820 ~ 16309416 (-)
prelid1a prelid1 coding upstream 52192 16316611 ~ 16323377 (-)
npy7r LOC104967498,LOC104930063,LOC103356978 coding upstream 60154 16324573 ~ 16329511 (-)
G105331 NA non-coding downstream 338 16263231 ~ 16263863 (-)
G105292 NA non-coding downstream 208173 16055583 ~ 16056028 (-)
G105289 NA non-coding downstream 304022 15959119 ~ 15960179 (-)
G105279 NA non-coding downstream 305441 15928617 ~ 15958760 (-)
G105253 NA non-coding downstream 359264 15902369 ~ 15904937 (-)
G105337 LOC103356977,LOC104930064,LOC102195804 non-coding upstream 69854 16334273 ~ 16339018 (-)
G105417 NA non-coding upstream 202029 16466448 ~ 16506278 (-)
LOC120567052 NA non-coding upstream 232038 16496457 ~ 16497322 (-)
G105433 NA non-coding upstream 423060 16687479 ~ 16687729 (-)
G105435 NA non-coding upstream 423637 16688056 ~ 16688590 (-)
unc5a unc5a,LOC102788949 other downstream 160407 15960197 ~ 16103794 (-)
hnrnph1 hnrnph1,LOC102791917 other downstream 392252 15866060 ~ 15871949 (-)
tspan17 tspan17,LOC103361971 other downstream 645093 15598343 ~ 15619108 (-)
G105086 NA other downstream 1129465 15133530 ~ 15134736 (-)
rnf44 rnf44 other downstream 1155603 15089404 ~ 15108598 (-)
gria3b LOC107394330,LOC106515969,LOC108242060,LOC101171999,LOC103357241,LOC104923180,LOC100695922,LOC102783061,LOC105925698,LOC107093457 other upstream 259937 16524356 ~ 16674855 (-)
rab9b rab9b,LOC103391151,LOC102204615,LOC100697336,LOC108436189,LOC103026314,LOC105912179 other upstream 693224 16957643 ~ 16963536 (-)
tmsb1 NA other upstream 877663 17142082 ~ 17151616 (-)
frmpd3 frmpd3 other upstream 902477 17166896 ~ 17256932 (-)
nexmifb kiaa2022 other upstream 1257722 17522141 ~ 17577811 (-)

Expression


Co-expression Network