G107888 (bcorl1)


Basic Information

Item Value
gene id G107888
gene name bcorl1
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053121.1
NCBI id CM020918.1
chromosome length 40300294
location 24884000 ~ 24884256 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU144965
TGATAGCCCAAGCGTGCAGCACGTTGTAGCAAAGTCTCCCCGGCATTTTTATTGACAATCAGCCGCCGAACCTCCGGAGGAACAGCCCTTTTTGGTGGAGAGTCTGAGCCGTTGCATCTCCCCAATGAGCCTCTCTTATTGGAAGGAGATGACGGCAAACTTTTTGGAGTGGGTGGGGGGCTTTCTGGTCTTTTTACAATAGCACCACCATCATCCAGGGCGAGTGAGGCAGCGCGCTTGCCCAAGCTGCTGCGTTT

Function

symbol description
bcorl1 Human ortholog(s) of this gene implicated in Shukla-Vernon syndrome. Orthologous to human BCORL1 (BCL6 corepressor like 1).

NR:

description
PREDICTED: BCL-6 corepressor-like protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU144965 True 257 lncRNA 0.54 1 24884000 24884256

Neighbor

gene id symbol gene type direction distance location
cstf2 cstf2 coding downstream 24628 24846892 ~ 24859372 (-)
arl13a arl13a,LOC102776915,LOC103352893 coding downstream 63507 24815085 ~ 24820493 (-)
tmem35 tmem35a coding downstream 74067 24807285 ~ 24809933 (-)
cenpi cenpi coding downstream 78262 24791383 ~ 24805738 (-)
drp2 drp2,LOC107724836 coding downstream 94087 24582963 ~ 24789913 (-)
mid1ip1l mid1ip1,LOC104928730,LOC103352948 coding upstream 24640 24908896 ~ 24911419 (-)
tspan7 tspan6,LOC104955938,LOC107378166 coding upstream 28307 24912563 ~ 24918751 (-)
sytl4 NA coding upstream 44445 24928701 ~ 24942371 (-)
trmt12 trmt12,LOC106611794 coding upstream 59192 24943448 ~ 24948186 (-)
sash3 sash3 coding upstream 99237 24983493 ~ 24993304 (-)
G107887 NA non-coding downstream 243 24883130 ~ 24883757 (-)
G107885 LOC104956976 non-coding downstream 2130 24876822 ~ 24881870 (-)
G107880 NA non-coding downstream 42948 24840827 ~ 24841052 (-)
G107874 xkrx,LOC102776626 non-coding downstream 48652 24824081 ~ 24835348 (-)
G107855 taf7l,taf7 non-coding downstream 320369 24561203 ~ 24563631 (-)
G107889 NA non-coding upstream 753 24885009 ~ 24885427 (-)
G107890 NA non-coding upstream 6045 24890301 ~ 24890716 (-)
G107903 NA non-coding upstream 92868 24977124 ~ 24980797 (-)
G107907 NA non-coding upstream 188925 25073181 ~ 25073832 (-)
G107923 NA non-coding upstream 296682 25180938 ~ 25186478 (-)
trnav-uac_15 NA other downstream 21816 24861970 ~ 24862184 (-)
G107864 LOC103353306,LOC105925836,LOC106916384,LOC103140164 other downstream 304901 24573441 ~ 24579099 (-)
rab41 rab41,rab6ba,LOC106515338,LOC106604734,LOC107696768 other downstream 895099 23884588 ~ 23988901 (-)
rnaseh2c rnaseh2c other downstream 1696942 23184192 ~ 23187058 (-)
G107284 LOC103374305,LOC102779018 other downstream 1749215 23129709 ~ 23134785 (-)
ndufa1 NA other upstream 378916 25263172 ~ 25264864 (-)
G107989 NA other upstream 395347 25279603 ~ 25288086 (-)
diaph2 NA other upstream 953074 25837330 ~ 26258199 (-)
rpl36a LOC106604455,LOC100304549,LOC100219516 other upstream 1573739 26457995 ~ 26460732 (-)
G108181 LOC103390578 other upstream 2105008 26989264 ~ 27001011 (-)

Expression


Co-expression Network