G111508



Basic Information


Item Value
gene id G111508
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 3113937 ~ 3114442 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU150185
actaaggtctatataaaagagacttcagatacagtattaggggaccactaaggtctatataaaagagacatcagatacagtattaggggaccactaaggtctatataaaagagacatcagatacagtattaggggaccactaaggtctatataaaagagacttcagatacagtattaggggaccactaaggtctatataaaagagacatcagatacagtattaggggacc

Function


GO:

id name namespace
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU150185 True 230 lncRNA 0.37 2 3113937 3114442

Neighbor


gene id symbol gene type direction distance location
LOC120568826 LOC106675582 coding upstream 380039 2732606 ~ 2733898 (+)
nmnat2 nmnat2 coding upstream 424721 2665824 ~ 2689216 (+)
LOC120568517 NA coding upstream 649097 2463673 ~ 2464840 (+)
LOC120567899 NA coding upstream 892046 2221448 ~ 2221891 (+)
LOC120567900 NA coding upstream 934334 2179109 ~ 2179603 (+)
ptmab NA coding downstream 184422 3298864 ~ 3304226 (+)
LOC120568524 NA coding downstream 481973 3596415 ~ 3600572 (+)
LOC120568326 NA coding downstream 601124 3715566 ~ 3715955 (+)
LOC120568529 NA coding downstream 689456 3803898 ~ 3807690 (+)
LOC120568332 NA coding downstream 701378 3815820 ~ 3825434 (+)
G111506 NA non-coding upstream 6556 3099395 ~ 3107381 (+)
G111485 NA non-coding upstream 15190 3046485 ~ 3098747 (+)
G111498 NA non-coding upstream 66090 3046939 ~ 3047847 (+)
G111495 NA non-coding upstream 88364 3023041 ~ 3025573 (+)
G111487 NA non-coding upstream 158828 2952608 ~ 2955109 (+)
G111512 NA non-coding downstream 3242 3117684 ~ 3118187 (+)
G111513 NA non-coding downstream 13664 3128106 ~ 3128413 (+)
G111515 NA non-coding downstream 19412 3133854 ~ 3134199 (+)
G111519 NA non-coding downstream 44070 3158512 ~ 3214758 (+)
G111522 LOC102313536 non-coding downstream 71441 3185883 ~ 3214972 (+)
G111494 NA other upstream 38036 3016958 ~ 3075901 (+)
G111484 NA other upstream 47908 2931639 ~ 3066029 (+)
G111486 LOC107102160,LOC102799505,LOC103352980 other upstream 173089 2938149 ~ 2940848 (+)
rasal2 NA other upstream 287083 2787779 ~ 2826854 (+)
LOC120567769 LOC102296991,LOC102211951,LOC102799200,LOC101465856 other downstream 273612 3388054 ~ 3399183 (+)
LOC120568331 NA other downstream 377147 3491589 ~ 3506128 (+)
LOC120568327 LOC102295145 other downstream 386237 3500679 ~ 3525115 (+)
LOC120568521 NA other downstream 426545 3540987 ~ 3852034 (+)
G111848 NA other downstream 974202 4088644 ~ 4137543 (+)

Expression



Co-expression Network