G111663



Basic Information


Item Value
gene id G111663
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 3047971 ~ 3050174 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU150448
aaaagacacacagacagactgaaaaagacacacagacagactgaaaaagacagacagacacacacagacagactgaaaaagacagacagacagacacacacagacagacttaaaaagacagacagacagacacacacagacagactgaaaaagacagacagacagacagacagacacacacagacagactgaaaaagacagacagacagacacagacagactgaaaaagacagacagacagacacacacagacagactgaaaaagacagacagacacacacagacagactgaaaaagacagacagacagacagacacagacagacagacacagacagacagacacagacagacagacacagacagacagacagacagacagacag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU150448 True 385 lncRNA 0.45 2 3047971 3050174
Loading

Neighbor


gene id symbol gene type direction distance location
LOC120568007 NA coding downstream 158232 2867255 ~ 2889739 (-)
LOC120568008 NA coding downstream 167655 2878147 ~ 2880316 (-)
LOC120568010 NA coding downstream 184237 2859574 ~ 2863734 (-)
LOC120568013 NA coding downstream 190348 2854923 ~ 2857623 (-)
LOC120568009 NA coding downstream 195583 2850025 ~ 2852388 (-)
LOC120568011 NA coding upstream 108028 3158202 ~ 3181305 (-)
LOC120568004 NA coding upstream 133408 3183582 ~ 3200853 (-)
LOC120568006 NA coding upstream 184194 3234368 ~ 3254369 (-)
LOC120568323 NA coding upstream 621376 3671550 ~ 3706170 (-)
LOC120568526 NA coding upstream 697123 3747297 ~ 3751140 (-)
G111638 NA non-coding downstream 22328 2932369 ~ 3025643 (-)
G111655 NA non-coding downstream 49444 2998074 ~ 2998527 (-)
G111650 NA non-coding downstream 62837 2984422 ~ 2985134 (-)
LOC120568014 NA non-coding downstream 72490 2967993 ~ 2975481 (-)
G111642 NA non-coding downstream 95546 2940178 ~ 2952425 (-)
G111659 NA non-coding upstream 15355 3065529 ~ 3066845 (-)
G111667 NA non-coding upstream 17668 3067842 ~ 3068680 (-)
G111662 NA non-coding upstream 20438 3070612 ~ 3145877 (-)
G111668 NA non-coding upstream 21429 3071603 ~ 3072192 (-)
G111640 NA non-coding upstream 32079 3082253 ~ 3082803 (-)
G111573 NA other downstream 469957 2573304 ~ 2578014 (-)
LOC120567903 NA other downstream 642878 2341462 ~ 2405093 (-)
LOC120567890 NA other downstream 1304132 1743300 ~ 1743839 (-)
G111226 NA other downstream 1630012 1412956 ~ 1417959 (-)
LOC120568022 NA other downstream 1638443 1391808 ~ 1409528 (-)
LOC120568005 NA other upstream 154113 3204287 ~ 3229147 (-)
LOC120568520 LOC101465856,LOC102211951,LOC102296991,LOC100703857,LOC103352978,LOC102799200 other upstream 264472 3314646 ~ 3371775 (-)
LOC120569104 NA other upstream 395226 3445400 ~ 3456534 (-)
G111942 NA other upstream 454324 3504498 ~ 4036963 (-)
LOC120568522 NA other upstream 514372 3564546 ~ 3585526 (-)

Expression


G111663 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G111663 Expression in each Bioproject

Bar chart with 5 bars.
G111663 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 175.
End of interactive chart.

Co-expression Network