G111701



Basic Information


Item Value
gene id G111701
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 3276295 ~ 3276671 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU150505
gttcagtgagtcagcatgcccaataccagggcctctcctaagtggaatgcagccatcattaatggtttaataccaggacctctcctaagtggaatgcagccatcagtaatggtttaataccaggacctctcctaagtggaatgcagccatcagtaatggtttaataccaggacctctcctaagtggaatgcagccatcagtaatggtttaataccagggcctctcctaagtggaatgcagccatcattaatggtttaataccagggtctctcctaagtggaat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU150505 True 283 lncRNA 0.46 2 3276295 3276671
Loading

Neighbor


gene id symbol gene type direction distance location
LOC120568006 NA coding downstream 21926 3234368 ~ 3254369 (-)
LOC120568004 NA coding downstream 75442 3183582 ~ 3200853 (-)
LOC120568011 NA coding downstream 94990 3158202 ~ 3181305 (-)
LOC120568007 NA coding downstream 386556 2867255 ~ 2889739 (-)
LOC120568323 NA coding upstream 394879 3671550 ~ 3706170 (-)
LOC120568526 NA coding upstream 470626 3747297 ~ 3751140 (-)
LOC120568321 NA coding upstream 472786 3749457 ~ 3760667 (-)
LOC120568324 NA coding upstream 584658 3861329 ~ 3871815 (-)
LOC120568530 NA coding upstream 607085 3883756 ~ 3889916 (-)
G111685 NA non-coding downstream 67635 3140019 ~ 3208660 (-)
G111690 NA non-coding downstream 158261 3117616 ~ 3118034 (-)
G111678 NA non-coding downstream 175962 3096244 ~ 3100333 (-)
G111680 NA non-coding downstream 177256 3098400 ~ 3099039 (-)
G111640 NA non-coding downstream 193492 3082253 ~ 3082803 (-)
G111704 NA non-coding upstream 27744 3304415 ~ 3305527 (-)
G111705 NA non-coding upstream 29164 3305835 ~ 3306933 (-)
G111706 NA non-coding upstream 37018 3313689 ~ 3313970 (-)
G111712 NA non-coding upstream 98600 3375271 ~ 3375715 (-)
G111713 NA non-coding upstream 100143 3376814 ~ 3377056 (-)
LOC120568005 NA other downstream 47148 3204287 ~ 3229147 (-)
LOC120568519 dlg1,LOC106568684,LOC105023059 other downstream 133841 2898215 ~ 3142454 (-)
G111573 NA other downstream 698281 2573304 ~ 2578014 (-)
LOC120567903 NA other downstream 871202 2341462 ~ 2405093 (-)
LOC120567890 NA other downstream 1532456 1743300 ~ 1743839 (-)
LOC120568520 LOC101465856,LOC102211951,LOC102296991,LOC100703857,LOC103352978,LOC102799200 other upstream 37975 3314646 ~ 3371775 (-)
LOC120569104 NA other upstream 168729 3445400 ~ 3456534 (-)
G111942 NA other upstream 227827 3504498 ~ 4036963 (-)
LOC120568522 NA other upstream 287875 3564546 ~ 3585526 (-)
LOC120568325 NA other upstream 352894 3629565 ~ 3633399 (-)

Expression


G111701 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G111701 Expression in each Bioproject

Bar chart with 8 bars.
G111701 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.

Co-expression Network