G111713



Basic Information


Item Value
gene id G111713
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 3376814 ~ 3377056 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU150521
accagggtctctcctaagtggaatgcagccatcagtaatggtttaataccagggcctctcctaagtggaatgcagccatcagtaatggtttaataccagggcctctcctaagtggaatgcagccatcagtaatggtttaataccagggcctctcctaagtggaatgcagccatcattaatggtttaataccaggacctctcctaagtggaatgcagccatcattaatggtttaataccaggac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU150521 True 243 lncRNA 0.46 1 3376814 3377056
Loading

Neighbor


gene id symbol gene type direction distance location
LOC120568006 NA coding downstream 122445 3234368 ~ 3254369 (-)
LOC120568004 NA coding downstream 175961 3183582 ~ 3200853 (-)
LOC120568011 NA coding downstream 195509 3158202 ~ 3181305 (-)
LOC120568007 NA coding downstream 487075 2867255 ~ 2889739 (-)
LOC120568323 NA coding upstream 294494 3671550 ~ 3706170 (-)
LOC120568526 NA coding upstream 370241 3747297 ~ 3751140 (-)
LOC120568321 NA coding upstream 372401 3749457 ~ 3760667 (-)
LOC120568324 NA coding upstream 484273 3861329 ~ 3871815 (-)
LOC120568530 NA coding upstream 506700 3883756 ~ 3889916 (-)
G111712 NA non-coding downstream 1099 3375271 ~ 3375715 (-)
G111706 NA non-coding downstream 62844 3313689 ~ 3313970 (-)
G111705 NA non-coding downstream 69881 3305835 ~ 3306933 (-)
G111704 NA non-coding downstream 71287 3304415 ~ 3305527 (-)
G111683 NA non-coding downstream 72476 3254475 ~ 3304338 (-)
G111714 LOC102211951,LOC102296991,LOC102799200,LOC101465856 non-coding upstream 11074 3388130 ~ 3397965 (-)
G111716 NA non-coding upstream 21182 3398238 ~ 3399183 (-)
G111740 NA non-coding upstream 60856 3437912 ~ 3439115 (-)
G111745 NA non-coding upstream 109800 3486856 ~ 3487202 (-)
G111750 NA non-coding upstream 116972 3494028 ~ 3494269 (-)
LOC120568520 LOC101465856,LOC102211951,LOC102296991,LOC100703857,LOC103352978,LOC102799200 other downstream 5039 3314646 ~ 3371775 (-)
LOC120568005 NA other downstream 147667 3204287 ~ 3229147 (-)
LOC120568519 dlg1,LOC106568684,LOC105023059 other downstream 234360 2898215 ~ 3142454 (-)
G111573 NA other downstream 798800 2573304 ~ 2578014 (-)
LOC120567903 NA other downstream 971721 2341462 ~ 2405093 (-)
LOC120569104 NA other upstream 68344 3445400 ~ 3456534 (-)
G111942 NA other upstream 127442 3504498 ~ 4036963 (-)
LOC120568522 NA other upstream 187490 3564546 ~ 3585526 (-)
LOC120568325 NA other upstream 252509 3629565 ~ 3633399 (-)
G112043 NA other upstream 861046 4238102 ~ 4238670 (-)

Expression


G111713 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G111713 Expression in each Bioproject

Bar chart with 8 bars.
G111713 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network