G111921


Basic Information

Item Value
gene id G111921
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 4621880 ~ 4639567 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU150860
gccagttatttcatggatccaggatactatgcatcctgataaagttcccttggcctttggaattaaaatagcccccccacatcatcacatacccttcaccatacccccacatcatcacatacccttcaccatacccccatatcatcacatacccttcaccatacccccacatcatcacatacccttcaacatacccccacatcatcacatacccttcaccatacccccacatcatcacatacccttcaccatacccccccatcatcacataccc

Function

GO: NA

KEGG:

id description
ko04151 PI3K-Akt signaling pathway
ko04512 ECM-receptor interaction
ko04510 Focal adhesion
ko04974 Protein digestion and absorption
ko05165 Human papillomavirus infection

RNA

RNA id representative length rna type GC content exon number start site end site
TU150860 True 274 lncRNA 0.48 2 4621880 4639567

Neighbor

gene id symbol gene type direction distance location
tmem71 NA coding upstream 147506 4458884 ~ 4474374 (+)
LOC120568271 NA coding upstream 203295 4416621 ~ 4418585 (+)
ift57 ift57,LOC102793808 coding upstream 228571 4377165 ~ 4393309 (+)
cavin4a murc,LOC104936762,LOC101469804,LOC100705704,LOC101164252 coding upstream 272722 4337085 ~ 4349158 (+)
crfb16 NA coding upstream 556859 4051320 ~ 4065021 (+)
LOC120567839 hhla1 coding downstream 165997 4805564 ~ 4835053 (+)
oc90 NA coding downstream 197897 4837464 ~ 4888212 (+)
adcy8 adcy8 coding downstream 559526 5199093 ~ 5336492 (+)
LOC120568538 NA coding downstream 764886 5404453 ~ 5408621 (+)
myo10 myo10 coding downstream 862116 5501683 ~ 5668717 (+)
G111906 NA non-coding upstream 101691 4518249 ~ 4520189 (+)
G111904 NA non-coding upstream 105133 4515700 ~ 4516747 (+)
G111893 NA non-coding upstream 125989 4452813 ~ 4495891 (+)
G111897 LOC102195644,LOC102307680,LOC106675584 non-coding upstream 133863 4484634 ~ 4488017 (+)
G111891 NA non-coding upstream 188777 4432508 ~ 4433103 (+)
G112140 NA non-coding downstream 149060 4788627 ~ 4788876 (+)
G112155 NA non-coding downstream 249034 4888601 ~ 4891470 (+)
G112154 NA non-coding downstream 251986 4891553 ~ 4894526 (+)
G112193 NA non-coding downstream 596817 5236384 ~ 5236973 (+)
G112195 NA non-coding downstream 637224 5276791 ~ 5277061 (+)
dnaaf11 NA other upstream 29533 4498994 ~ 4592347 (+)
G111910 NA other upstream 75798 4545425 ~ 4546082 (+)
tmeff1a tmeff1,LOC102775778 other upstream 295694 4212124 ~ 4326186 (+)
G111850 LOC102799398 other upstream 482947 4090508 ~ 4138933 (+)
G111848 NA other upstream 484337 4088644 ~ 4137543 (+)
LOC120568547 LOC106674584,LOC106676354,LOC106675207,LOC106675343,LOC106676464,LOC106676424,LOC106675739 other downstream 1148656 5788223 ~ 5789417 (+)
epdr1 epdr1,LOC104965688 other downstream 1344290 5983857 ~ 5993711 (+)
LOC120568055 NA other downstream 1364118 6003685 ~ 6016600 (+)
G112400 NA other downstream 1611823 6251390 ~ 6321990 (+)
LOC120568552 dip2c other downstream 1935229 6574796 ~ 6682272 (+)

Expression


Co-expression Network