G112018 (LOC102799398)


Basic Information

Item Value
gene id G112018
gene name LOC102799398
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 4090508 ~ 4138931 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU151022
AAGCCTCCTGATTTGCTCTGTGATCTCCCTGTCTCTTCCTATTCCTCTTGTGTCCCCAAACCCTGGTGTGTCCACAATGGTCAGAGAGAAGGGGACTTTAAACCCCTCTTGGTAGTTGATTTTGTACACAGTGGCTTCAGATGTCTGACTTTCAGATTGTGATCTTGTCTGATCCTCCTCAATTAATTTGAATCTGAAACTGTCCTTCCACTCCACACCAACAATGTAGTTGATCATTCCATTGATCAGAGTAGACTTTCCTGATCCAGTTGCTCCAAGAAGCATTATTGTGCGATTTTGCCTCATGCTTTCTTTGCCAAGGTTATACCTCCGGCACCCATCGAAATCCATATCTTCTTCTTTCAGAGGCAGTTTGTAAACTGATGGAGATTCAGAATGTATTCTCTTGCTAATATGTTTGAGGAACTCGACAAGATGTGCATTTTCCTGTTTTGTTGTGCGTACAGTAACAGGGATGCTTTCTTTGCTTCTGCCAGCTACATATTGTGTATCTGACTGAAGCTCTGATATTATTGCCTTTTCTGCTCCTGCCATCATTTTGTTCCATTGGAGATCTTCCTCTTTCATCCCGTTGTCTGTGTTGGCGTGTACTCCACGATGTTGCTCAAATTATGGACATCTTGTCCAAGCCCAGCAGGTTTCTCCCAGCTAACTGATATCTCTCTTGAATTTGGTT

Function

NR:

description
PREDICTED: uncharacterized protein LOC102799398

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU151022 True 697 lncRNA 0.43 2 4090508 4138931
Loading

Neighbor

gene id symbol gene type direction distance location
cldn15la LOC104937175,LOC107383743,LOC108229378 coding downstream 62922 4021167 ~ 4027586 (-)
saga LOC100700585,LOC102198835,LOC102289605,LOC101471160,LOC103367699,LOC102794384 coding downstream 72246 4001441 ~ 4018262 (-)
proca NA coding downstream 106513 3972332 ~ 3983995 (-)
LOC120568530 NA coding downstream 200592 3883756 ~ 3889916 (-)
LOC120568324 NA coding downstream 218693 3861329 ~ 3871815 (-)
slc39a6 slc39a6 coding upstream 6932 4145863 ~ 4168656 (-)
LOC120567835 LOC106949703,LOC103156008,LOC107087008 coding upstream 348397 4487328 ~ 4499789 (-)
LOC120567837 NA coding upstream 366791 4505722 ~ 4510614 (-)
si:dkey-7l6.3 NA coding upstream 380430 4519361 ~ 4527181 (-)
efr3a efr3a coding upstream 756330 4895261 ~ 5063854 (-)
LOC120567799 NA non-coding downstream 8426 4074729 ~ 4082082 (-)
G112007 NA non-coding downstream 50311 4039884 ~ 4040197 (-)
G111997 NA non-coding downstream 121290 3967994 ~ 3969218 (-)
LOC120568335 NA non-coding downstream 269318 3800195 ~ 3821190 (-)
LOC120568342 NA non-coding downstream 369386 3718266 ~ 3721122 (-)
G112048 NA non-coding upstream 148848 4287779 ~ 4288307 (-)
G112050 NA non-coding upstream 167272 4306203 ~ 4306723 (-)
G112061 NA non-coding upstream 253919 4392850 ~ 4409467 (-)
G112068 NA non-coding upstream 289587 4428518 ~ 4495792 (-)
G112069 NA non-coding upstream 290096 4429027 ~ 4480919 (-)
G111942 NA other downstream 53545 3504498 ~ 4036963 (-)
LOC120568325 NA other downstream 457109 3629565 ~ 3633399 (-)
LOC120568522 NA other downstream 504982 3564546 ~ 3585526 (-)
LOC120569104 NA other downstream 633974 3445400 ~ 3456534 (-)
LOC120568520 LOC101465856,LOC102211951,LOC102296991,LOC100703857,LOC103352978,LOC102799200 other downstream 718733 3314646 ~ 3371775 (-)
G112043 NA other upstream 99171 4238102 ~ 4238670 (-)
G112046 NA other upstream 128607 4267538 ~ 4284083 (-)
G112233 NA other upstream 1525073 5664004 ~ 5668687 (-)
LOC120568546 NA other upstream 1584802 5723733 ~ 5746081 (-)
G112328 NA other upstream 1654232 5793163 ~ 5852447 (-)

Expression

G112018(LOC102799398) Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G112018(LOC102799398) Expression in each Bioproject

Bar chart with 5 bars.
G112018(LOC102799398) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3.
End of interactive chart.

Co-expression Network