G112162


Basic Information

Item Value
gene id G112162
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 4804638 ~ 4804959 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU151214
gggtaagggttaaggttaggcatttagttgtgatggttaaggttagggtaagggttaaggttaggcatttagttgtgatggttaaggttagggtaagggttaaggttaggcatttagttgtgatggttaaggttagggtaagggttaaggttaggcatttagttgtgatggttaaggttagggtaagggttaaggttaggcatttagttgtgatggttaaggttaggctaagggttaaggttaggcatttagttgtgatggttaaggttagggtaag

Function

NR:

description
3-mercaptopyruvate sulfurtransferase-like

GO:

id name namespace
GO:0006508 proteolysis biological_process

KEGG:

id description
ko04080 Neuroactive ligand-receptor interaction
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption
ko05164 Influenza A

RNA

RNA id representative length rna type GC content exon number start site end site
TU151214 True 277 lncRNA 0.40 2 4804638 4804959

Neighbor

gene id symbol gene type direction distance location
si:dkey-7l6.3 NA coding downstream 277457 4519361 ~ 4527181 (-)
LOC120567837 NA coding downstream 294024 4505722 ~ 4510614 (-)
LOC120567835 LOC106949703,LOC103156008,LOC107087008 coding downstream 304849 4487328 ~ 4499789 (-)
slc39a6 slc39a6 coding downstream 635982 4145863 ~ 4168656 (-)
si:ch73-170d6.2 NA coding downstream 683287 4110746 ~ 4121351 (-)
efr3a efr3a coding upstream 90302 4895261 ~ 5063854 (-)
LOC120568537 NA coding upstream 303082 5108041 ~ 5148701 (-)
basp1 NA coding upstream 619032 5423991 ~ 5486661 (-)
march11 march11 coding upstream 879257 5684216 ~ 5699240 (-)
znf622 znf622 coding upstream 900645 5705604 ~ 5718217 (-)
G112142 NA non-coding downstream 8241 4792332 ~ 4796397 (-)
G112122 NA non-coding downstream 139176 4633890 ~ 4665462 (-)
G112121 NA non-coding downstream 174805 4615038 ~ 4629833 (-)
G112095 NA non-coding downstream 195645 4501094 ~ 4608993 (-)
G112094 NA non-coding downstream 262456 4495364 ~ 4542182 (-)
LOC120567597 NA non-coding upstream 67792 4872751 ~ 4886268 (-)
G112176 NA non-coding upstream 109865 4914824 ~ 4915244 (-)
G112177 NA non-coding upstream 119232 4924191 ~ 4980099 (-)
G112180 NA non-coding upstream 203639 5008598 ~ 5008996 (-)
G112183 NA non-coding upstream 263015 5067974 ~ 5068299 (-)
G112046 NA other downstream 520555 4267538 ~ 4284083 (-)
G112043 NA other downstream 565968 4238102 ~ 4238670 (-)
G111942 NA other downstream 767675 3504498 ~ 4036963 (-)
G112233 NA other upstream 859045 5664004 ~ 5668687 (-)
LOC120568546 NA other upstream 918774 5723733 ~ 5746081 (-)
G112328 NA other upstream 988204 5793163 ~ 5852447 (-)
LOC120567959 NA other upstream 1367322 6172281 ~ 6178886 (-)
zmynd11 zmynd11 other upstream 1890651 6695610 ~ 6736512 (-)

Expression


Co-expression Network