G113553 (xrn1,LOC103355159)


Basic Information

Item Value
gene id G113553
gene name xrn1,LOC103355159
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 10911500 ~ 10912177 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU153078
GTTGTTTCTGGATAGGACCCTTAGAGGGAGAGTTCCTGTTGCCCTGGGAGGCTGCCTTCCCCATACCATGTTTATTGTTATGCTGTGTGGGTATAAAGGGTGAACGTGGAGAGTGGTTCAGGCCGGACAACTGGCGTTGTGAGTTGAAGTTTGCGGCTGTGGTGGGCTGAGGTTTGACGATGGCGGTGAGTTTGTGGGAGGTTTGATCCACTCGCGTTCCGTGGGAAAAGTTAATGAGAG

Function

symbol description
xrn1 Predicted to enable 5'-3' exoribonuclease activity and RNA binding activity. Predicted to be involved in nuclear-transcribed mRNA catabolic process and rRNA catabolic process. Predicted to be located in cytoplasm. Predicted to be active in nucleus. Human ortholog(s) of this gene implicated in Alzheimer's disease. Orthologous to human XRN1 (5'-3' exoribonuclease 1).

NR:

description
PREDICTED: 5'-3' exoribonuclease 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU153078 True 240 lncRNA 0.52 2 10911500 10912177

Neighbor

gene id symbol gene type direction distance location
pappa2 pappa2 coding downstream 49892 10755896 ~ 10861608 (-)
map4l LOC103364124,LOC102200499,LOC102297845,LOC108238623,LOC107384193,LOC102781692,LOC104942656 coding downstream 1123280 9674884 ~ 9788220 (-)
fitm1l LOC103375111,LOC104934817,LOC102294302,LOC101483423 coding downstream 1347759 9551992 ~ 9563741 (-)
ankrd45 NA coding downstream 1373938 9534265 ~ 9537562 (-)
cryz cryz coding downstream 1552967 9352318 ~ 9358533 (-)
col15a1b NA coding upstream 10391 10922568 ~ 10996589 (-)
LOC120568748 LOC103355153,LOC104929170 coding upstream 94702 11006879 ~ 11043741 (-)
LOC120567858 LOC103355152 coding upstream 143661 11055838 ~ 11094619 (-)
ctnnd2b ctnnd2,LOC101475998,LOC102313221,LOC100711149,LOC102780722 coding upstream 239250 11151427 ~ 11321003 (-)
zswim5 zswim5 coding upstream 478707 11390884 ~ 11462612 (-)
LOC120569033 NA non-coding downstream 500170 10410527 ~ 10411330 (-)
LOC120569031 NA non-coding downstream 532699 10372699 ~ 10378801 (-)
G113457 NA non-coding downstream 871615 10039657 ~ 10039885 (-)
LOC120567726 NA non-coding downstream 997834 9906924 ~ 9913666 (-)
G113438 NA non-coding downstream 1087743 9822437 ~ 9823757 (-)
G113627 NA non-coding upstream 206825 11119002 ~ 11123476 (-)
LOC120568658 NA non-coding upstream 412429 11324606 ~ 11329834 (-)
G113653 NA non-coding upstream 445557 11357734 ~ 11403230 (-)
G113656 NA non-coding upstream 453194 11365371 ~ 11367604 (-)
G113667 NA non-coding upstream 512007 11424184 ~ 11446271 (-)
LOC120567758 NA other downstream 22548 10887007 ~ 10888952 (-)
brinp2 brinp2,LOC103369811 other downstream 644422 10040686 ~ 10267078 (-)
LOC120568397 NA other downstream 1401003 9400787 ~ 9510497 (-)
chd7 chd7,LOC103370133,LOC102782711 other downstream 1716628 9114384 ~ 9194872 (-)
G113070 NA other downstream 2121458 8780452 ~ 8790042 (-)
G113805 NA other upstream 1305885 12218062 ~ 12218267 (-)
nedd8l LOC104931181,LOC104949953,LOC107384241,LOC103360313 other upstream 1689003 12601180 ~ 12608569 (-)
LOC120568934 LOC104956577 other upstream 1848571 12760748 ~ 12768625 (-)
LOC120568578 wdr48 other upstream 2054289 12966466 ~ 12975328 (-)
G114152 NA other upstream 2172384 13084561 ~ 13088563 (-)

Expression


Co-expression Network