G116484 (rock1)


Basic Information

Item Value
gene id G116484
gene name rock1
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 20768635 ~ 20771028 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU157004
CCCTCATCTGTCCCTCGTTGCCTCTGTATTGTTTGGTCAGCTGTGCCAGCTGGAACTCCAGCGAGCGTTTACTCTCTAGTGCTGTGTTGATCTCCTGTTTGAGCTGCTTCTCTGAACACCTAAGACGGTCCACCTCCTGCGTGCGGCTCTTCAGGTCGTTCTGAGACTGGACACGCTTGCTCGACTCCTGTTCTCCCTGTATCCGCAGATTCTTCACCTCATCTTCCAGCCTCTCTTTTTGCTTCATCAGCTGCTCCATCTTCTGCACCGACTGCTTGAGGTCAAACTCTAACATCGAGCACTGCTTCTCAACCTCCACTACCCGGCTCTCCGCTCGCATCCTCGCGCCGTTCTCCTCCGACATCTTCTGCTGAACAGCTGGAGTAGAACAGTGACGGGAAAACAATCACTTCCTTGTCGGCAATTTATTTAGTTTCAAATTCGATTGATTTTTTTGTTCTACTGCCAACTGATGTGAGAATATCAACTTGGTAACCCTGAACTCACACTGAACAATCCATCTGTGCGATATGTAACAATTCTAAAA

Function

symbol description
rock1 Predicted to enable Rho-dependent protein serine/threonine kinase activity. Involved in epicardial cell to mesenchymal cell transition; negative regulation of adherens junction organization; and positive regulation of stress fiber assembly. Acts upstream of or within regulation of cytoskeleton organization. Predicted to be located in plasma membrane. Predicted to be active in cytoplasmic stress granule and cytoskeleton. Is expressed in forebrain and hindbrain. Orthologous to human ROCK1 (Rho associated coiled-coil containing protein kinase 1).

NR:

description
PREDICTED: rho-associated protein kinase 1 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU157004 True 547 lncRNA 0.49 3 20768635 20771028

Neighbor

gene id symbol gene type direction distance location
greb1l NA coding downstream 28606 20693367 ~ 20740029 (-)
mib1 mib1 coding downstream 92809 20620288 ~ 20675826 (-)
gata6 gata6 coding downstream 173473 20588784 ~ 20595162 (-)
cables1 cables1 coding downstream 210338 20533111 ~ 20558297 (-)
mmp16b LOC103369336 coding downstream 312757 20438467 ~ 20455878 (-)
thoc1 thoc1 coding upstream 21716 20792744 ~ 20799545 (-)
LOC120569019 aqp1,LOC103358082,LOC101079855,LOC104917699 coding upstream 44621 20815649 ~ 20818164 (-)
myl13 myl3,LOC105919861,LOC102217899,LOC107395748 coding upstream 149568 20920596 ~ 20923664 (-)
ccdc13 NA coding upstream 230952 21001980 ~ 21006127 (-)
jmjd4 jmjd4,LOC102786139 coding upstream 280311 21051339 ~ 21053776 (-)
LOC120568747 NA non-coding downstream 182958 20580520 ~ 20585677 (-)
G116368 LOC101078271 non-coding downstream 376915 20390357 ~ 20391720 (-)
G116366 NA non-coding downstream 380573 20387498 ~ 20388062 (-)
G116328 NA non-coding downstream 442761 20325649 ~ 20325874 (-)
G116292 LOC107655868,LOC106532782,LOC108241678 non-coding downstream 831222 19924212 ~ 19937413 (-)
G116499 NA non-coding upstream 35125 20806153 ~ 20806691 (-)
G116508 NA non-coding upstream 56484 20827512 ~ 20827711 (-)
G116525 NA non-coding upstream 147941 20918969 ~ 20919716 (-)
G116580 NA non-coding upstream 287564 21058592 ~ 21061240 (-)
G116582 NA non-coding upstream 336486 21107514 ~ 21107718 (-)
xcr1b.1 NA other downstream 972876 19793342 ~ 19795759 (-)
G116138 NA other downstream 1303255 19464700 ~ 19465380 (-)
G116084 LOC104943419,LOC103361571,LOC101479291 other downstream 1545909 19221791 ~ 19222726 (-)
LOC120568972 LOC104949378,LOC103135673,LOC106524506,LOC103479814,LOC106906961,LOC102205181 other downstream 1833144 18931974 ~ 18935491 (-)
G115941 NA other downstream 1922358 18844905 ~ 18846277 (-)
tmie tmie,LOC102776014 other upstream 213773 20984801 ~ 20995567 (-)
higd1a higd1a other upstream 237020 21008048 ~ 21010576 (-)
G116969 NA other upstream 1490970 22261998 ~ 22268559 (-)
LOC120569135 ttc39c,LOC102790819 other upstream 2574690 23345718 ~ 23361580 (-)
G117259 vps4b other upstream 2659338 23430366 ~ 23430992 (-)

Expression


Co-expression Network