G117847 (pax7,LOC106964226,LOC102296763)


Basic Information

Item Value
gene id G117847
gene name pax7,LOC106964226,LOC102296763
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 25916500 ~ 25916722 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU158843
GGGCTTGCTGCCTCCGATGGCCCCCGGCCGGATGGAGCCGGTCTCCTGGTACCGGCACAGGATTTTGGAGACGCAGCCGTGGGACACGCGCAGTTGACGGGAGATGACACACGGCCGGACACCGTGATGGGCCATCTCCACGATTTTATGGCGGATGTGGTTGGGGAGAGGCCTGCCGTTAATGAAGACACCGCCGAGCTGGTTGACCCGACCCTGTCCCAAC

Function

symbol description
pax7 Enables sequence-specific double-stranded DNA binding activity. Predicted to be involved in anatomical structure development and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within several processes, including animal organ development; chordate embryonic development; and positive regulation of nitrogen compound metabolic process. Predicted to be located in nucleus. Predicted to be part of chromatin. Implicated in alveolar rhabdomyosarcoma.

NR:

description
PREDICTED: paired box protein Pax-7 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU158843 True 223 lncRNA 0.64 1 25916500 25916722

Neighbor

gene id symbol gene type direction distance location
LOC120568896 NA coding upstream 105220 25808021 ~ 25811280 (+)
LOC120568352 ephb1,LOC103359190,LOC105935923,LOC107384019,LOC106599529,LOC106907045 coding upstream 358868 25376185 ~ 25557632 (+)
LOC120568394 LOC103359187 coding upstream 562717 25281304 ~ 25353783 (+)
gpc5c LOC103359185,LOC104919215 coding upstream 654159 25140737 ~ 25262341 (+)
LOC120568127 NA coding upstream 802698 25085974 ~ 25113802 (+)
acsl3b LOC103356873,LOC102195906 coding downstream 14819 25931541 ~ 25944450 (+)
scg2b LOC104966178,LOC102792743 coding downstream 43084 25959806 ~ 25963171 (+)
LOC120568964 dhrs12,LOC103356877,LOC100697743 coding downstream 51888 25968610 ~ 25972306 (+)
LOC120567653 LOC104919205,LOC102308383,LOC100712433,LOC101483053,LOC102214738,LOC102794313,LOC104966180,LOC103396000,LOC106528146,LOC108245529,LOC102232174,LOC103479388 coding downstream 83500 26000222 ~ 26046169 (+)
kcnab1b LOC103356881,LOC103395998,LOC101482076,LOC102213317,LOC102305142,LOC104919203,LOC101062207 coding downstream 156649 26073371 ~ 26115398 (+)
G117846 NA non-coding upstream 10184 25906115 ~ 25906316 (+)
G117845 LOC103356872,LOC107087289 non-coding upstream 11369 25904913 ~ 25905131 (+)
LOC120568898 NA non-coding upstream 27659 25880504 ~ 25888841 (+)
LOC120568900 NA non-coding upstream 43098 25872329 ~ 25873402 (+)
LOC120568901 NA non-coding upstream 123309 25782175 ~ 25793191 (+)
G117917 NA non-coding downstream 141532 26058254 ~ 26065839 (+)
G117933 NA non-coding downstream 287889 26204611 ~ 26204830 (+)
G117938 NA non-coding downstream 291634 26208356 ~ 26208871 (+)
G118009 NA non-coding downstream 397543 26314265 ~ 26314630 (+)
G118095 NA non-coding downstream 615444 26532166 ~ 26601409 (+)
G117829 NA other upstream 85805 25829764 ~ 25830695 (+)
LOC120568895 NA other upstream 122546 25773777 ~ 25793954 (+)
LOC120568894 LOC102789372,LOC104966552 other upstream 143032 25743327 ~ 25773468 (+)
fgf12a fgf12,LOC100711708,LOC108245531,LOC107083782,LOC107384013,LOC103396031,LOC103365152,LOC103148287,LOC101467833,LOC106535044,LOC102236041,LOC105935916 other upstream 872443 24987499 ~ 25044057 (+)
G117664 NA other upstream 962253 24950568 ~ 24954247 (+)
LOC120567655 LOC103356880,LOC101482764,LOC104966182,LOC107087304 other downstream 132067 26048789 ~ 26051099 (+)
LOC120568800 NA other downstream 297710 26214432 ~ 26217041 (+)
ece2a ece2,LOC103356888 other downstream 301276 26217998 ~ 26309547 (+)
G118011 eif4e2 other downstream 478704 26395426 ~ 26402078 (+)
ccl20a.3 NA other downstream 499786 26416508 ~ 26418008 (+)

Expression


Co-expression Network