G117917



Basic Information


Item Value
gene id G117917
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 26058254 ~ 26065839 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU158959
GACCTCTCTCTTCAGATCCTCTAATTGTTTTTCAGTGTTCTTCAGTTTGGCCTCCAGGTCTCTTAAGATGTCAAAAAGGTGCCAATGGTTTATCTGGCTCCCTGTTATGTCACCAGCACAGGGACATGTTCGCTCGACGTTGGGAATCTCTATGCTGGAGCCCTGTTCTGCTTGGTCATCCAGCTGCTGCACCTCAGCCACACTAAGGTAGAAGAGGGATAAAGTCAACACAGCCACGGAGGTCTTCATCTTTTTACTTACTTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU158959 True 264 lncRNA 0.48 2 26058254 26065839
Loading

Neighbor


gene id symbol gene type direction distance location
LOC120567653 LOC104919205,LOC102308383,LOC100712433,LOC101483053,LOC102214738,LOC102794313,LOC104966180,LOC103396000,LOC106528146,LOC108245529,LOC102232174,LOC103479388 coding upstream 12085 26000222 ~ 26046169 (+)
LOC120568964 dhrs12,LOC103356877,LOC100697743 coding upstream 85948 25968610 ~ 25972306 (+)
scg2b LOC104966178,LOC102792743 coding upstream 95083 25959806 ~ 25963171 (+)
acsl3b LOC103356873,LOC102195906 coding upstream 113804 25931541 ~ 25944450 (+)
LOC120568896 NA coding upstream 246974 25808021 ~ 25811280 (+)
kcnab1b LOC103356881,LOC103395998,LOC101482076,LOC102213317,LOC102305142,LOC104919203,LOC101062207 coding downstream 7532 26073371 ~ 26115398 (+)
pask NA coding downstream 50093 26115932 ~ 26130177 (+)
mterf4 NA coding downstream 65364 26131203 ~ 26134522 (+)
LOC120567725 NA coding downstream 69297 26135136 ~ 26139505 (+)
klhl24a klhl24 coding downstream 73822 26139661 ~ 26163512 (+)
G117847 pax7,LOC106964226,LOC102296763 non-coding upstream 141532 25916500 ~ 25916722 (+)
G117846 NA non-coding upstream 151938 25906115 ~ 25906316 (+)
G117845 LOC103356872,LOC107087289 non-coding upstream 153123 25904913 ~ 25905131 (+)
LOC120568898 NA non-coding upstream 169413 25880504 ~ 25888841 (+)
LOC120568900 NA non-coding upstream 184852 25872329 ~ 25873402 (+)
G117933 NA non-coding downstream 138772 26204611 ~ 26204830 (+)
G117938 NA non-coding downstream 142517 26208356 ~ 26208871 (+)
G118009 NA non-coding downstream 248426 26314265 ~ 26314630 (+)
G118095 NA non-coding downstream 466327 26532166 ~ 26601409 (+)
G118098 NA non-coding downstream 482817 26548656 ~ 26605084 (+)
LOC120567655 LOC103356880,LOC101482764,LOC104966182,LOC107087304 other upstream 7155 26048789 ~ 26051099 (+)
G117829 NA other upstream 227559 25829764 ~ 25830695 (+)
LOC120568895 NA other upstream 264300 25773777 ~ 25793954 (+)
LOC120568894 LOC102789372,LOC104966552 other upstream 284786 25743327 ~ 25773468 (+)
fgf12a fgf12,LOC100711708,LOC108245531,LOC107083782,LOC107384013,LOC103396031,LOC103365152,LOC103148287,LOC101467833,LOC106535044,LOC102236041,LOC105935916 other upstream 1014197 24987499 ~ 25044057 (+)
LOC120568800 NA other downstream 148593 26214432 ~ 26217041 (+)
ece2a ece2,LOC103356888 other downstream 152159 26217998 ~ 26309547 (+)
G118011 eif4e2 other downstream 329587 26395426 ~ 26402078 (+)
ccl20a.3 NA other downstream 350669 26416508 ~ 26418008 (+)
wdr47a wdr47,LOC102290984 other downstream 355615 26421454 ~ 26496809 (+)

Expression


G117917 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network