G118345 (mbd3,LOC104929650,LOC108239474)


Basic Information

Item Value
gene id G118345
gene name mbd3,LOC104929650,LOC108239474
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 27183708 ~ 27187200 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU159516
GTTTCGGTTGGTCCACAGCCTTCTGCGGGTCTGTCTTCACCTTGTTGTTGGGATGATTGGTTACCTTGGTCACTGGTTGTTTGAAGATGGATGCTGTCTGTCGAACTGGTAGTGTTGTGTTTAAATCAGGCTTGGCCCTGATTTGATGGTTGATGTCATAGAAATTCTTGTGCCTGCTGCGCTGCACTTTGGTCAGGAGCGACCATCCGGCTCGGGAGTGGCTGGCATTCACATCTGTGTGAAGGTTGCTGCCCAGACTGCGGACTATCTGGGGCTTGTTGAAAATGCGCTTAACAGGTACCTTTTCTTTCCATGGTCTTGGCTGTCTTTATTTGTTTGTCTCCAATTCTGGCTCATAAAAGATAAGAAGCCAGCTATCTGACTATTACTGCAGTCATAATGTTTCACCGAGTCTGGTTTGTTATCGATCCCCGCTGTCTGTCTCCCGTCAGGACCTTCACAACTGCAGATCACTCCGCCAGCCTTGTAAACACACTGAGCGGAAGACATCCGCCACGCGCCTGTAAAATAGTCCGAACATGACGCGCCAGGTTTCACATGATATGTTCACG

Function

symbol description
mbd3 Enables methyl-CpG binding activity. Contributes to nucleosomal DNA binding activity. Involved in chromatin remodeling. Located in chromatin. Part of protein-containing complex.

NR:

description
PREDICTED: methyl-CpG-binding domain protein 3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU159516 True 572 lncRNA 0.49 3 27183708 27187200

Neighbor

gene id symbol gene type direction distance location
onecut3b onecut3,LOC103366680,LOC106923038,LOC107096950,LOC102305143 coding downstream 75982 27095802 ~ 27107726 (-)
LOC120567768 NA coding downstream 181656 26998041 ~ 27002052 (-)
plekhj1 plekhj1 coding downstream 192935 26986732 ~ 26990773 (-)
LOC120568414 LOC102790141,LOC102302803,LOC104929656,LOC105934591,LOC102195635,LOC100696847,LOC101486463 coding downstream 198662 26977016 ~ 26985046 (-)
sugp1 sugp1 coding downstream 293811 26881797 ~ 26889897 (-)
LOC120567762 LOC101482480,LOC102795251 coding upstream 23815 27211015 ~ 27244441 (-)
LOC120567764 LOC107384141,LOC100708490,LOC108239462,LOC107096963,LOC101482186,LOC106526414 coding upstream 65334 27252534 ~ 27261346 (-)
sirt6 sirt6 coding upstream 108170 27295370 ~ 27307660 (-)
LOC120567993 LOC104929644,LOC104964218,LOC103364385,LOC106951435 coding upstream 123105 27310305 ~ 27317595 (-)
sema4e LOC103364382 coding upstream 141882 27329082 ~ 27338096 (-)
G118341 NA non-coding downstream 1138 27179112 ~ 27182570 (-)
G118321 NA non-coding downstream 40800 27080007 ~ 27142908 (-)
G118308 LOC107384102,LOC105934594,LOC104929657,LOC103366675,LOC108239475,LOC103395958,LOC102222760 non-coding downstream 219956 26960400 ~ 26963752 (-)
G118186 NA non-coding downstream 451624 26731877 ~ 26732084 (-)
G118165 NA non-coding downstream 582323 26532167 ~ 26601385 (-)
G118339 NA non-coding upstream 11382 27198582 ~ 27199689 (-)
G118401 NA non-coding upstream 107083 27294283 ~ 27295300 (-)
G118482 NA non-coding upstream 391768 27578968 ~ 27609694 (-)
G118483 LOC103364371,LOC101475014,LOC102207447,LOC108239424 non-coding upstream 415201 27602401 ~ 27605241 (-)
G118504 NA non-coding upstream 440686 27627886 ~ 27664712 (-)
cirbpa cirbp other downstream 359138 26819838 ~ 26824570 (-)
G118175 NA other downstream 517756 26661621 ~ 26665952 (-)
camk2n1a camk2n2 other downstream 864113 26315770 ~ 26319595 (-)
G117732 NA other downstream 2260390 24922203 ~ 24923318 (-)
G117560 NA other downstream 2647212 24499380 ~ 24536496 (-)
LOC120568986 epha4,LOC100711706 other upstream 456127 27643327 ~ 27675360 (-)
G118524 NA other upstream 526267 27713467 ~ 27718759 (-)
metap1d metap1d,LOC102783095 other upstream 959071 28146271 ~ 28152770 (-)
G118764 NA other upstream 1798891 28986091 ~ 28986319 (-)
G118856 NA other upstream 2233179 29420379 ~ 29420652 (-)

Expression


Co-expression Network