G119285


Basic Information

Item Value
gene id G119285
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 31641354 ~ 31643198 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU160703
ctgtaaccaagtttatatatccccgcgccgtttatagctttattataagtatatgtcaacaatgtgcacagaatggtcgacgcactttcacctgcacccgtcaggaaacgggagaaagctttgaagtgggacgtatgaagttatgtccacaactacgagggtgtgactgaagtacccctgttgagctgcatcacagctgcactatgtgcatggacctgtgccagtcagcacattactcacctgtgtgcagaggacaggcagcagtagcacaaaccaagaagggtgcacaaccaggcctgggagagaaaattactgatgtccacaaaaccaaatcagagaaggagcatactatacaaagacaacagtggagagttcctggatcggtctgtcctcaaagtgccagagatctacaaggacttcacccttttctgcaccatcagcgtataatcaaagtgataaaagagagaacaaattattgttttctctgttgacatgaataggtgcctgtaatgtctgcccatatattcaatcaattcaataaatgttgataagtatcactgatatttcttaaatcattgtagtttttcagagcaataagatacaga

Function

GO:

id name namespace
GO:0008152 metabolic process biological_process
GO:0055114 oxidation-reduction process biological_process

KEGG:

id description
ko00680 Methane metabolism
ko00260 Glycine, serine and threonine metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
TU160703 True 605 lncRNA 0.43 4 31641354 31643198

Neighbor

gene id symbol gene type direction distance location
LOC120568980 NA coding upstream 187894 31431806 ~ 31453460 (+)
LOC120567691 LOC107740693 coding upstream 630030 31007722 ~ 31011324 (+)
LOC120568730 LOC101472437,LOC102310659,LOC102778004,LOC103360659,LOC106534850 coding upstream 1422632 30101634 ~ 30218722 (+)
LOC120569133 NA coding upstream 1584245 30055815 ~ 30057109 (+)
LOC120569089 NA coding upstream 1595164 30044894 ~ 30046190 (+)
eif3f eif3f coding downstream 217532 31860730 ~ 31865235 (+)
LOC120568893 LOC100705068 coding downstream 285947 31929145 ~ 31939478 (+)
lig1 lig1,LOC102777267 coding downstream 299005 31942203 ~ 32016352 (+)
mpz mpz,LOC102776110 coding downstream 388454 32031652 ~ 32051435 (+)
LOC120568430 LOC103373937,LOC105937883,LOC100694151 coding downstream 431878 32075076 ~ 32115947 (+)
LOC120568739 NA non-coding upstream 30593 31608971 ~ 31610761 (+)
G119266 LOC103364416 non-coding upstream 151518 31477086 ~ 31489836 (+)
G119265 NA non-coding upstream 165507 31475565 ~ 31475847 (+)
G119264 NA non-coding upstream 168836 31469594 ~ 31472518 (+)
G119255 NA non-coding upstream 186937 31453788 ~ 31454417 (+)
G119306 LOC103370525 non-coding downstream 86947 31730145 ~ 31731290 (+)
G119328 NA non-coding downstream 195184 31838382 ~ 31842971 (+)
G119332 NA non-coding downstream 206242 31849440 ~ 31915601 (+)
LOC120567918 NA non-coding downstream 412857 32056055 ~ 32059373 (+)
G119398 NA non-coding downstream 481366 32124564 ~ 32124915 (+)
G119257 NA other upstream 180446 31459864 ~ 31460908 (+)
G119123 NA other upstream 405789 31198960 ~ 31235565 (+)
G119114 NA other upstream 437768 31165226 ~ 31203586 (+)
LOC120568595 sdr16c5 other upstream 964002 30569095 ~ 30677352 (+)
LOC120567689 NA other upstream 1671441 29963415 ~ 29969913 (+)
dnaaf6 pih1d3,LOC106903480,LOC103138000,LOC103138005,LOC103137996,LOC106960166 other downstream 222557 31865755 ~ 31869495 (+)
pip4p1a tmem55b,LOC101161334 other downstream 245710 31888908 ~ 31914704 (+)
LOC120567694 LOC103373937,LOC106569580,LOC100136182,LOC107383461,LOC106960171 other downstream 424365 32067563 ~ 32071312 (+)
cadm3 cadm3 other downstream 485260 32128458 ~ 32226483 (+)
LOC120568569 NA other downstream 809507 32452705 ~ 32471570 (+)

Expression


Co-expression Network