G119622 (pex19)


Basic Information

Item Value
gene id G119622
gene name pex19
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 32836081 ~ 32837200 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU161135
GGTTGGCATCTGCATCATGTAAGCACTAGTGTGAGCAGTTAATCAGTCAAATGCAGAGTGTGTCTACCTTTTGCATCAGTTCCATGATGCTCTCGAACACCCCTTCTTTATCTGCTGCCCCCTGTTCCTCCCTCTCAAAGTGCTTACAGATCTCTCCCATGATGTTGGCCTGCTGTTCATAGCGCTGGTAGTCGTCTGGGCTAAGGCTTGGCTTATTGGCATCCAACCATTCTGGGTACTTAGCAGTGATCTCTTTGAGAGATGGATAAAGCACTTCCTTCGAGAGGAGATTCTGCATGATTGACTGCATGATGGGAAGGATGTTTCCGTCCTCGCCGCCTCCTTCGCCACCCTCGTCCAATCCCAGGCCTTCTAGAGCCTTGACGAGGTCGTCTCCAGCTAGTCCAGAGGACTG

Function

symbol description
pex19 Predicted to enable peroxisome membrane targeting sequence binding activity. Predicted to be involved in protein import into peroxisome membrane. Predicted to act upstream of or within peroxisome organization. Predicted to be located in membrane and peroxisome. Predicted to be integral component of membrane. Predicted to be active in peroxisomal membrane. Human ortholog(s) of this gene implicated in peroxisome biogenesis disorder 12A. Orthologous to human PEX19 (peroxisomal biogenesis factor 19).

NR:

description
PREDICTED: peroxisomal biogenesis factor 19

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU161135 True 415 lncRNA 0.51 2 32836081 32837200

Neighbor

gene id symbol gene type direction distance location
LOC120568452 LOC103367094 coding upstream 114470 32716753 ~ 32721611 (+)
si:ch211-155e24.3 si:ch211-155e24.3,LOC108427093,LOC107549816,LOC107750208,LOC107671805 coding upstream 179224 32651304 ~ 32656857 (+)
LOC120568820 LOC101162955,LOC103374738 coding upstream 249732 32575313 ~ 32586349 (+)
LOC120568570 NA coding upstream 349673 32472620 ~ 32486408 (+)
LOC120568571 NA coding upstream 394986 32437458 ~ 32441095 (+)
myadmb LOC104961532,LOC101466547 coding downstream 5899 32843099 ~ 32852397 (+)
ltb4r2b NA coding downstream 92251 32929451 ~ 32938337 (+)
sdr39u1 sdr39u1 coding downstream 104006 32941206 ~ 32945386 (+)
parp2 parp2 coding downstream 116076 32953276 ~ 32973757 (+)
apol1 LOC106928621,LOC103148595,LOC106953189,LOC103370244 coding downstream 213805 33051005 ~ 33070053 (+)
G119586 NA non-coding upstream 42586 32793017 ~ 32793495 (+)
G119583 vangl2,LOC103367097 non-coding upstream 65127 32770428 ~ 32770954 (+)
G119579 NA non-coding upstream 78428 32757383 ~ 32757653 (+)
G119556 NA non-coding upstream 125709 32709295 ~ 32710372 (+)
G119541 NA non-coding upstream 201362 32633628 ~ 32634719 (+)
G119623 pex19 non-coding downstream 103 32837303 ~ 32838088 (+)
G119624 NA non-coding downstream 1804 32839004 ~ 32840813 (+)
G119638 NA non-coding downstream 59531 32896731 ~ 32897048 (+)
G119639 NA non-coding downstream 59915 32897115 ~ 32897468 (+)
G119640 NA non-coding downstream 60547 32897747 ~ 32898018 (+)
G119585 NA other upstream 54610 32780988 ~ 32781471 (+)
G119584 vangl2,LOC102795188 other upstream 60399 32775074 ~ 32775682 (+)
G119582 vangl2,LOC103137974 other upstream 66229 32768707 ~ 32769852 (+)
LOC120568569 NA other upstream 364511 32452705 ~ 32471570 (+)
cadm3 cadm3 other upstream 609598 32128458 ~ 32226483 (+)
tep1 LOC104950563,LOC104941471 other downstream 151617 32988817 ~ 33049081 (+)
LOC120568463 NA other downstream 326716 33163916 ~ 33166100 (+)
G119769 grk7,LOC106528614,LOC104920904 other downstream 467622 33304822 ~ 33307864 (+)
pkn2a pkn2 other downstream 640136 33477336 ~ 33515424 (+)
gng12a gng12,LOC104920945,LOC104956611,LOC103354642 other downstream 973768 33810968 ~ 33851937 (+)

Expression


Co-expression Network