G119639



Basic Information


Item Value
gene id G119639
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 32897115 ~ 32897468 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU161155
gcataccagagggtactgcatggcgctgcaaaatgctctggtagccgttttggttcagggtgcctttcactctgtacaaatcaccgaccctggatccagcaaaacagccccagaccatcacgcttcctcctccatgtttgacagttgatgtcacacactgaggaaccatcctttcgcctactcaacggcgtacaaaaatcctgcgtgatgaaccgaagatttcaaatttggattcatcagtccatagcaccttcttccagtcttcagtagtccattggcagtgtttcttggcccaggcaagcctctttttcttattctgatgtcttagcaatggctttcttgctgcaactcgac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU161155 True 354 lncRNA 0.49 1 32897115 32897468
Loading

Neighbor


gene id symbol gene type direction distance location
myadmb LOC104961532,LOC101466547 coding upstream 44718 32843099 ~ 32852397 (+)
LOC120568452 LOC103367094 coding upstream 175504 32716753 ~ 32721611 (+)
si:ch211-155e24.3 si:ch211-155e24.3,LOC108427093,LOC107549816,LOC107750208,LOC107671805 coding upstream 240258 32651304 ~ 32656857 (+)
LOC120568820 LOC101162955,LOC103374738 coding upstream 310766 32575313 ~ 32586349 (+)
LOC120568570 NA coding upstream 410707 32472620 ~ 32486408 (+)
ltb4r2b NA coding downstream 31983 32929451 ~ 32938337 (+)
sdr39u1 sdr39u1 coding downstream 43738 32941206 ~ 32945386 (+)
parp2 parp2 coding downstream 55808 32953276 ~ 32973757 (+)
apol1 LOC106928621,LOC103148595,LOC106953189,LOC103370244 coding downstream 153537 33051005 ~ 33070053 (+)
LOC120567698 LOC107098800,LOC105889457,LOC102791798 coding downstream 178315 33075783 ~ 33126800 (+)
G119638 NA non-coding upstream 67 32896731 ~ 32897048 (+)
G119624 NA non-coding upstream 56302 32839004 ~ 32840813 (+)
G119623 pex19 non-coding upstream 59027 32837303 ~ 32838088 (+)
G119622 pex19 non-coding upstream 59915 32836081 ~ 32837200 (+)
G119586 NA non-coding upstream 103620 32793017 ~ 32793495 (+)
G119640 NA non-coding downstream 279 32897747 ~ 32898018 (+)
G119733 NA non-coding downstream 283988 33181456 ~ 33185892 (+)
G119744 NA non-coding downstream 295119 33192587 ~ 33193199 (+)
G119763 NA non-coding downstream 370902 33268370 ~ 33269202 (+)
G119767 NA non-coding downstream 392862 33290330 ~ 33290580 (+)
G119585 NA other upstream 115644 32780988 ~ 32781471 (+)
G119584 vangl2,LOC102795188 other upstream 121433 32775074 ~ 32775682 (+)
G119582 vangl2,LOC103137974 other upstream 127263 32768707 ~ 32769852 (+)
LOC120568569 NA other upstream 425545 32452705 ~ 32471570 (+)
cadm3 cadm3 other upstream 670632 32128458 ~ 32226483 (+)
tep1 LOC104950563,LOC104941471 other downstream 91349 32988817 ~ 33049081 (+)
LOC120568463 NA other downstream 266448 33163916 ~ 33166100 (+)
G119769 grk7,LOC106528614,LOC104920904 other downstream 407354 33304822 ~ 33307864 (+)
pkn2a pkn2 other downstream 579868 33477336 ~ 33515424 (+)
gng12a gng12,LOC104920945,LOC104956611,LOC103354642 other downstream 913500 33810968 ~ 33851937 (+)

Expression


G119639 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G119639 Expression in each Bioproject

Bar chart with 8 bars.
G119639 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network