G120062


Basic Information

Item Value
gene id G120062
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 33987432 ~ 33987907 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU161697
tagagtctctaaaagtagaatgggagctagagccttcagttatcaggctcctctcctatggaaccagctcccgatctgggttcggggggcagaaactgtcacctcattcaagaatgaacttaaaactctcctatttgataaagcttatagttagggagtgaggagttgcagtgttcacctaactggcccaactgcttctcttcataattgttagattaataatacataacaaagtagagggaggcaggccagccaagccagatccggcagggggagagttctaagcccgaaaaagctacctctccttatgacctgtctctcttagttacctgttatagttacgctgttatagtcctagactgccgggggacttccttcctttgacacactgagctgctctctcctctccctttctattactgtttctattactgttactattactattactatttgtgtgcagcccgtcccagaaa

Function

GO: NA

KEGG:

id description
ko04512 ECM-receptor interaction
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU161697 True 476 lncRNA 0.45 1 33987432 33987907

Neighbor

gene id symbol gene type direction distance location
dmbx1a dmbx1,LOC102206215,LOC102778954,LOC100697381,LOC103354234 coding upstream 48654 33929067 ~ 33938778 (+)
wls wls coding upstream 177756 33768879 ~ 33809676 (+)
scinlb LOC106958286,LOC106904251,LOC103149535 coding upstream 219653 33743259 ~ 33767779 (+)
ccdc18 NA coding upstream 257792 33701632 ~ 33729640 (+)
mtf2 mtf2 coding upstream 288646 33682701 ~ 33698786 (+)
ptger4c LOC104920997,LOC103353922,LOC100696844 coding downstream 16988 34004895 ~ 34007251 (+)
nr2f6a LOC104920957,LOC101167397,LOC106911939 coding downstream 255931 34243838 ~ 34253143 (+)
angptl4 LOC103369125 coding downstream 437392 34425299 ~ 34432504 (+)
mast3a LOC104920969,LOC103357775 coding downstream 542648 34530555 ~ 34565654 (+)
ifi30 NA coding downstream 630645 34618552 ~ 34622369 (+)
G120059 NA non-coding upstream 4029 33982997 ~ 33983403 (+)
G120058 pif1 non-coding upstream 10545 33975828 ~ 33976887 (+)
LOC120569017 NA non-coding upstream 116648 33867395 ~ 33870784 (+)
G119963 NA non-coding upstream 118746 33868386 ~ 33868686 (+)
G119961 NA non-coding upstream 119432 33867769 ~ 33868000 (+)
G120069 NA non-coding downstream 24771 34012678 ~ 34012883 (+)
G120064 NA non-coding downstream 54645 34042552 ~ 34111347 (+)
G120120 NA non-coding downstream 156519 34144426 ~ 34146446 (+)
G120125 LOC104920953,LOC104954835,LOC103395859 non-coding downstream 166012 34153919 ~ 34157980 (+)
G120199 LOC107100640,LOC106535681 non-coding downstream 324882 34312789 ~ 34313388 (+)
LOC120568585 LOC108244495 other upstream 29928 33955166 ~ 33957504 (+)
G119957 gadd45a,LOC106598934,LOC106568974 other upstream 127585 33858542 ~ 33859847 (+)
gng12a gng12,LOC104920945,LOC104956611,LOC103354642 other upstream 135495 33810968 ~ 33851937 (+)
pkn2a pkn2 other upstream 472008 33477336 ~ 33515424 (+)
G119769 grk7,LOC106528614,LOC104920904 other upstream 679568 33304822 ~ 33307864 (+)
mrpl34 NA other downstream 176173 34164080 ~ 34165852 (+)
LOC120568953 dda1,LOC105024194,LOC106568965,LOC104920954 other downstream 179069 34166976 ~ 34172309 (+)
G120200 NA other downstream 329241 34317148 ~ 34317766 (+)
rps28 NA other downstream 412841 34400748 ~ 34404001 (+)
G120249 rps15,rig,rs15 other downstream 465815 34453722 ~ 34457611 (+)

Expression


Co-expression Network