LOC120568228



Basic Information


Item Value
gene id LOC120568228
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 25125831 ~ 25130929 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>XR_005640686.1
ACAGAGTGGAGGGACTGGGAGCGTACAGAGAAGCCTTGCCCACAGGCGAGGGCATGCGGGTGGGGCATGGGCATGCGTTCCTGGGGGTCCGGCATGGTAATGGAGCCCATACATCACGGGGTGCACCAGTCCACACTGGCAACCCCCAAAATATAGCAACCTGCTATTGCCACAGGGACCCTCTGGCCACTTGTCCTAATTTCCTACAACCTCTTTCTGAAGTGAACCCAGTGACATCCTTGCATTTACAGAGAAGAATGAGCCACAGCATGTAACGAATGTCCTATTTCTCTCATTCCTGGCGTGGTCTAAGTTCTGAGCTACCAGGCCGTTGTAGGCTCTCAGCCCATTCTCCTCAACGTACTGGAAAAAACGGAGAGTTTCTTCCTCTTTGGAGCTCATCATTCTTCAAGTGTTTCCACAGCATTCTGATGAAGACATATAGAACATGTTAGTGATAATTGGTTGCCTTAACAAGATAGATACACAAAGTACTCCTAATAATATGAACTACAAGGGCGTCATATAGTACGGGTATGGTCTGAATGCGAAACAAGCATGCTGTCATGTCAGTAATCATTCTCATCTCAACCCTCCTTTTACAAGGTCAGCCTTGATGAGATAAAAACCGACGAAGCAAGATTGCATCAGCATTGTAATAAAGTCACACAATAGAGTTGA

Function


GO:

id name namespace
GO:0043292 contractile fiber cellular_component
GO:0044449 obsolete contractile fiber part cellular_component
GO:0036379 myofilament cellular_component
GO:0005861 troponin complex cellular_component
GO:0005865 striated muscle thin filament cellular_component
GO:0030016 myofibril cellular_component
GO:0030017 sarcomere cellular_component

KEGG:

id description
ko04260 Cardiac muscle contraction
ko04261 Adrenergic signaling in cardiomyocytes
ko05410 Hypertrophic cardiomyopathy
ko05414 Dilated cardiomyopathy

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005640686.1 True 681 lncRNA 0.47 3 25125831 25130929

Neighbor


gene id symbol gene type direction distance location
LOC120568127 NA coding upstream 12029 25085974 ~ 25113802 (+)
extl2 extl2 coding upstream 129629 24992144 ~ 24996202 (+)
rc3h1b rc3h1 coding upstream 144951 24965665 ~ 24980880 (+)
LOC120568131 otol1,LOC104951468 coding upstream 185952 24936959 ~ 24939879 (+)
LOC120568308 NA coding upstream 214496 24907837 ~ 24911335 (+)
gpc5c LOC103359185,LOC104919215 coding downstream 9808 25140737 ~ 25262341 (+)
LOC120568394 LOC103359187 coding downstream 150375 25281304 ~ 25353783 (+)
LOC120568352 ephb1,LOC103359190,LOC105935923,LOC107384019,LOC106599529,LOC106907045 coding downstream 245256 25376185 ~ 25557632 (+)
LOC120568896 NA coding downstream 677092 25808021 ~ 25811280 (+)
acsl3b LOC103356873,LOC102195906 coding downstream 800612 25931541 ~ 25944450 (+)
G117704 NA non-coding upstream 7329 25118231 ~ 25118502 (+)
G117632 NA non-coding upstream 287602 24837956 ~ 24838229 (+)
G117547 NA non-coding upstream 569174 24556419 ~ 24556657 (+)
LOC120568139 NA non-coding upstream 786575 24337693 ~ 24339256 (+)
G117523 NA non-coding upstream 867000 24257554 ~ 24258831 (+)
LOC120568901 NA non-coding downstream 651246 25782175 ~ 25793191 (+)
LOC120568900 NA non-coding downstream 741400 25872329 ~ 25873402 (+)
LOC120568898 NA non-coding downstream 749575 25880504 ~ 25888841 (+)
G117845 LOC103356872,LOC107087289 non-coding downstream 773984 25904913 ~ 25905131 (+)
G117846 NA non-coding downstream 775186 25906115 ~ 25906316 (+)
fgf12a fgf12,LOC100711708,LOC108245531,LOC107083782,LOC107384013,LOC103396031,LOC103365152,LOC103148287,LOC101467833,LOC106535044,LOC102236041,LOC105935916 other upstream 81774 24987499 ~ 25044057 (+)
G117664 NA other upstream 171584 24950568 ~ 24954247 (+)
selenot1a selenot,LOC103365166 other upstream 255744 24862996 ~ 24870087 (+)
LOC120569045 cacybp other upstream 450077 24667879 ~ 24675754 (+)
LOC120568789 kiaa0040,LOC102782613 other upstream 547519 24569528 ~ 24578312 (+)
LOC120568894 LOC102789372,LOC104966552 other downstream 612398 25743327 ~ 25773468 (+)
LOC120568895 NA other downstream 642848 25773777 ~ 25793954 (+)
G117829 NA other downstream 698835 25829764 ~ 25830695 (+)
LOC120567655 LOC103356880,LOC101482764,LOC104966182,LOC107087304 other downstream 917860 26048789 ~ 26051099 (+)
LOC120568800 NA other downstream 1083503 26214432 ~ 26217041 (+)

Expression


LOC120568228 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

LOC120568228 Expression in each Bioproject

Bar chart with 6 bars.
LOC120568228 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network