LOC120568901



Basic Information


Item Value
gene id LOC120568901
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 25782175 ~ 25793191 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>XR_005640804.1
ACAGAGTCATGGATCGGTTTACATTGTACTTCTCTCTCCTGTTGGGGTTCCTACTTTATGATGCTCAACCAGCAGCTCCAACAGGCTGTGCAGGTCCACCCGTGCTGTGTTGTCCTGGTCAAAACAACTCCTGCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005640804.1 True 135 lncRNA 0.50 3 25782175 25793191
Loading

Neighbor


gene id symbol gene type direction distance location
LOC120568352 ephb1,LOC103359190,LOC105935923,LOC107384019,LOC106599529,LOC106907045 coding upstream 224543 25376185 ~ 25557632 (+)
LOC120568394 LOC103359187 coding upstream 428392 25281304 ~ 25353783 (+)
gpc5c LOC103359185,LOC104919215 coding upstream 519834 25140737 ~ 25262341 (+)
LOC120568127 NA coding upstream 668373 25085974 ~ 25113802 (+)
extl2 extl2 coding upstream 785973 24992144 ~ 24996202 (+)
LOC120568896 NA coding downstream 14830 25808021 ~ 25811280 (+)
acsl3b LOC103356873,LOC102195906 coding downstream 138350 25931541 ~ 25944450 (+)
scg2b LOC104966178,LOC102792743 coding downstream 166615 25959806 ~ 25963171 (+)
LOC120568964 dhrs12,LOC103356877,LOC100697743 coding downstream 175419 25968610 ~ 25972306 (+)
LOC120567653 LOC104919205,LOC102308383,LOC100712433,LOC101483053,LOC102214738,LOC102794313,LOC104966180,LOC103396000,LOC106528146,LOC108245529,LOC102232174,LOC103479388 coding downstream 207031 26000222 ~ 26046169 (+)
LOC120568228 NA non-coding upstream 651246 25125831 ~ 25130929 (+)
G117704 NA non-coding upstream 663673 25118231 ~ 25118502 (+)
G117632 NA non-coding upstream 943946 24837956 ~ 24838229 (+)
G117547 NA non-coding upstream 1225518 24556419 ~ 24556657 (+)
LOC120568139 NA non-coding upstream 1442919 24337693 ~ 24339256 (+)
LOC120568900 NA non-coding downstream 79138 25872329 ~ 25873402 (+)
LOC120568898 NA non-coding downstream 87313 25880504 ~ 25888841 (+)
G117845 LOC103356872,LOC107087289 non-coding downstream 111722 25904913 ~ 25905131 (+)
G117846 NA non-coding downstream 112924 25906115 ~ 25906316 (+)
G117847 pax7,LOC106964226,LOC102296763 non-coding downstream 123309 25916500 ~ 25916722 (+)
LOC120568894 LOC102789372,LOC104966552 other upstream 8707 25743327 ~ 25773468 (+)
fgf12a fgf12,LOC100711708,LOC108245531,LOC107083782,LOC107384013,LOC103396031,LOC103365152,LOC103148287,LOC101467833,LOC106535044,LOC102236041,LOC105935916 other upstream 738118 24987499 ~ 25044057 (+)
G117664 NA other upstream 827928 24950568 ~ 24954247 (+)
selenot1a selenot,LOC103365166 other upstream 912088 24862996 ~ 24870087 (+)
LOC120569045 cacybp other upstream 1106421 24667879 ~ 24675754 (+)
G117829 NA other downstream 36573 25829764 ~ 25830695 (+)
LOC120567655 LOC103356880,LOC101482764,LOC104966182,LOC107087304 other downstream 255598 26048789 ~ 26051099 (+)
LOC120568800 NA other downstream 421241 26214432 ~ 26217041 (+)
ece2a ece2,LOC103356888 other downstream 424807 26217998 ~ 26309547 (+)
G118011 eif4e2 other downstream 602235 26395426 ~ 26402078 (+)

Expression


LOC120568901 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

LOC120568901 Expression in each Bioproject

Bar chart with 3 bars.
LOC120568901 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network