G121941


Basic Information

Item Value
gene id G121941
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053123.1
NCBI id CM020920.1
chromosome length 39440604
location 4195664 ~ 4196007 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU164028
gtccgatttcggatttcaattgaatgtatttttgtgaatgtcagagttaggaggaggctagctagctctcattgatggactccatctcaccgtggctctatcaatgagactcgcggacaaggctttatttccccgattgtttgtttaaataactcaacacacatacccattataagattaactggaacctgcgggctgcggtaaaagattgcgggcgtaacaagctcgctgacactgcggtcagggcggcgatgtagcaacccaggcagcaccaacaccggcactaaactccgacacacagtcggagaaaatttgcaattagccatccattttcgtaaagcggc

Function

NR:

description
PREDICTED: leucine--tRNA ligase, cytoplasmic

GO:

id name namespace
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU164028 True 344 lncRNA 0.48 1 4195664 4196007

Neighbor

gene id symbol gene type direction distance location
trim63b trim63,LOC103367607,LOC102793986,LOC102215866 coding upstream 128903 4064863 ~ 4066761 (+)
LOC120570277 dpp10 coding upstream 344769 3609281 ~ 3850895 (+)
mmadhcb mmadhc coding upstream 796821 3393829 ~ 3398843 (+)
nmi NA coding upstream 802457 3382869 ~ 3393207 (+)
itgb2 NA coding upstream 838508 3318800 ~ 3357156 (+)
mlphb NA coding downstream 18417 4214424 ~ 4278611 (+)
LOC120570038 NA coding downstream 182408 4378415 ~ 4394022 (+)
LOC120569241 LOC103373060 coding downstream 198051 4394058 ~ 4398874 (+)
maip1 LOC101475169,LOC100711160,LOC102305852,LOC102192410 coding downstream 213857 4409864 ~ 4416440 (+)
pgap1 pgap1 coding downstream 220846 4416853 ~ 4436351 (+)
LOC120570435 NA non-coding upstream 63304 4084213 ~ 4132360 (+)
G121921 NA non-coding upstream 66956 4124919 ~ 4128708 (+)
G121919 col6a3 non-coding upstream 74604 4118108 ~ 4121060 (+)
G121912 NA non-coding upstream 122968 4072462 ~ 4072696 (+)
G121906 NA non-coding upstream 170982 4024398 ~ 4024682 (+)
LOC120570443 NA non-coding downstream 17381 4213388 ~ 4213760 (+)
G122021 NA non-coding downstream 245610 4441617 ~ 4445127 (+)
G122022 LOC103376870 non-coding downstream 251088 4447095 ~ 4447339 (+)
G122024 NA non-coding downstream 252250 4448257 ~ 4448460 (+)
G122034 NA non-coding downstream 386812 4582819 ~ 4583029 (+)
G121917 col6a3 other upstream 85231 4108030 ~ 4110433 (+)
cops8 cops8 other upstream 123550 4061037 ~ 4072114 (+)
ndufv3 NA other upstream 1224332 2962205 ~ 2971332 (+)
pde9a pde9a other upstream 1276915 2868579 ~ 2918749 (+)
LOC120570676 NA other upstream 1354801 2840759 ~ 2840863 (+)
lrrfip1a lrrfip1,LOC102295012,LOC102195615,LOC100691582,LOC103370951,LOC107396304,LOC107099056 other downstream 98844 4294851 ~ 4352923 (+)
G122036 NA other downstream 522278 4718285 ~ 4720843 (+)
zgc:136439 LOC103367146,LOC106581848,LOC101483704 other downstream 620082 4816089 ~ 4818139 (+)
G122128 NA other downstream 698778 4894785 ~ 4895502 (+)
fkbp7 fkbp7,LOC102196462,LOC104949636 other downstream 778782 4974789 ~ 4982979 (+)

Expression


Co-expression Network