G122858 (map3k19)


Basic Information

Item Value
gene id G122858
gene name map3k19
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053123.1
NCBI id CM020920.1
chromosome length 39440604
location 8790317 ~ 8790556 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU165227
CCTGTGAAGGATGCTGGCGATGGATCCTCCTGGGACGTATTCCATGAAAATGGAAACCACATGCTGATAAAGTGAGGTACCCAGGAAGCCCACAATGTTGGTGTGTCTGAGGGTTTTGAGCAGCTCCACTTCCCCCTGCAGACGACTGTACTCCCTCTTTGCATCGTCGGGGTCAGAGGCATCCAGTCTCACCTGCTTCACAGCTATCAGCTGGCCCTGGCTGGTCAGGCCACAGTACAC

Function

symbol description
map3k19 Predicted to enable ATP binding activity and protein serine/threonine kinase activity. Predicted to act upstream of or within protein phosphorylation. Orthologous to human MAP3K19 (mitogen-activated protein kinase kinase kinase 19).

NR:

description
PREDICTED: mitogen-activated protein kinase kinase kinase 19

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU165227 True 240 lncRNA 0.55 1 8790317 8790556

Neighbor

gene id symbol gene type direction distance location
ramp1 ramp1,LOC100698743,LOC101467429,LOC102789017 coding downstream 18395 8701569 ~ 8771922 (-)
LOC120570417 NA coding downstream 204799 8584580 ~ 8585518 (-)
adarb1b adarb1,LOC101485294,LOC102308976,LOC100709054 coding downstream 207741 8442118 ~ 8582576 (-)
asb1 asb1,LOC102790951 coding downstream 392792 8387273 ~ 8397525 (-)
LOC120570227 LOC104955246 coding downstream 445965 8341303 ~ 8344352 (-)
acmsd acmsd coding upstream 13819 8804375 ~ 8810586 (-)
LOC120569317 NA coding upstream 97307 8887863 ~ 8901784 (-)
pth2ra pth2r coding upstream 243356 9033912 ~ 9122327 (-)
mrasa mras coding upstream 356036 9146592 ~ 9175548 (-)
LOC120569925 LOC103368088,LOC100695821 coding upstream 585973 9376529 ~ 9474839 (-)
G122838 NA non-coding downstream 66735 8647857 ~ 8723582 (-)
G122830 NA non-coding downstream 177623 8604526 ~ 8612694 (-)
G122828 NA non-coding downstream 178454 8512070 ~ 8611863 (-)
G122820 NA non-coding downstream 408196 8381886 ~ 8382121 (-)
G122814 NA non-coding downstream 473591 8314022 ~ 8316726 (-)
G122859 map3k19,LOC104941527 non-coding upstream 108 8790664 ~ 8790898 (-)
G122863 NA non-coding upstream 90887 8881443 ~ 8885620 (-)
LOC120569286 NA non-coding upstream 214773 9005329 ~ 9005993 (-)
G122934 NA non-coding upstream 426254 9216810 ~ 9287702 (-)
G122950 NA non-coding upstream 533844 9324400 ~ 9324800 (-)
traf3ip1 traf3ip1 other downstream 341887 8399585 ~ 8448430 (-)
tmeff2a tmeff2 other downstream 1472685 7181931 ~ 7317632 (-)
pcbp3 pcbp3,LOC100710924,LOC107660579,LOC103138153 other downstream 1919105 6782446 ~ 6871212 (-)
LOC120569614 NA other downstream 2108323 6640881 ~ 6681994 (-)
G122404 NA other downstream 2776122 6012040 ~ 6014195 (-)
ccnt2a ccnt2,ccnt2a,LOC104923135,LOC102200362 other upstream 3065 8793621 ~ 8803104 (-)
G122878 NA other upstream 208906 8999462 ~ 9000123 (-)
stxbp5l stxbp5l other upstream 2149497 10940053 ~ 11094619 (-)
thsd7ba NA other upstream 2490054 11280610 ~ 11467939 (-)
LOC120570668 LOC103354235,LOC105936145,LOC100692075,LOC108240393,LOC104918665 other upstream 3441864 12232420 ~ 12245005 (-)

Expression


Co-expression Network