G124612 (myo3b)



Basic Information


Item Value
gene id G124612
gene name myo3b
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053123.1
NCBI id CM020920.1
chromosome length 39440604
location 17176156 ~ 17180098 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU167579
GTCTCCCTGCAAGGCTTCGTTACACTGTCTTCTGCTCTGCCTTTGTCTCTCTTGAAGTCTTTCACTTGTCTGTCTCGGCTGTCGAGGCCAACATTTCCTCTATGTATGTGATCGGTATGTGCCTCCTTGCTTTCTGAATTGTTAGACCCCGTATGCTCCTCCTTGGTGGTCTTTTCTCCAGCCTCAGGGTGACATATGTGCTCCTGGGTTACATGGTCCCGACGCACCCGATGGCCCCTGTAAGCTGACTGAATGCAGATAGCGGCCTCTTCCCGCTCCTTTTTT

Function


symbol description
myo3b Predicted to enable several functions, including ATP binding activity; actin binding activity; and cytoskeletal motor activity. Predicted to act upstream of or within protein phosphorylation and visual perception. Predicted to be part of myosin complex. Orthologous to human MYO3B (myosin IIIB).

NR:

description
PREDICTED: myosin-IIIb isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU167579 True 285 lncRNA 0.52 4 17176156 17180098

Neighbor


gene id symbol gene type direction distance location
mettl5 mettl5,LOC102779255 coding downstream 98031 17074358 ~ 17078125 (-)
ccdc173 NA coding downstream 117845 17049924 ~ 17058311 (-)
LOC120570071 lrp2 coding downstream 191017 16974305 ~ 16985139 (-)
lrp2a lrp2 coding downstream 199989 16938250 ~ 16976167 (-)
abcb11a abcb11,LOC102784145 coding downstream 271016 16895676 ~ 16905140 (-)
tlk1a tlk1 coding upstream 70284 17250382 ~ 17271042 (-)
mettl8 mettl8 coding upstream 91642 17271740 ~ 17277883 (-)
slc25a12 slc25a12,LOC102297988 coding upstream 124673 17304771 ~ 17324588 (-)
dlx2a dlx2,LOC102799862 coding upstream 204665 17384763 ~ 17386999 (-)
nup62l nup62,LOC104948257 coding upstream 241769 17421867 ~ 17424329 (-)
G124606 NA non-coding downstream 48612 17124881 ~ 17127544 (-)
G124580 ppig non-coding downstream 62093 17048006 ~ 17114063 (-)
G124601 ubr3 non-coding downstream 77128 17094443 ~ 17099028 (-)
G124590 phgdh,LOC102779828 non-coding downstream 110619 17062706 ~ 17065537 (-)
G124588 NA non-coding downstream 115866 17057779 ~ 17060290 (-)
G124679 NA non-coding upstream 47801 17227899 ~ 17230116 (-)
G124673 NA non-coding upstream 68271 17248369 ~ 17338260 (-)
G124693 NA non-coding upstream 107851 17287949 ~ 17290438 (-)
G124695 NA non-coding upstream 111829 17291927 ~ 17294640 (-)
G124691 NA non-coding upstream 167813 17347911 ~ 17350746 (-)
fastkd1 fastkd1,LOC102780871 other downstream 133784 17035373 ~ 17042372 (-)
LOC120570068 LOC103362129,LOC101485094 other downstream 786262 16381250 ~ 16389894 (-)
gcgb gcg other downstream 795391 16378488 ~ 16380765 (-)
LOC120570587 LOC100705152,LOC102292123,LOC101476258 other downstream 953420 16207690 ~ 16222736 (-)
G124303 dapl1 other downstream 1074563 16099278 ~ 16101593 (-)
LOC120569287 LOC103391581,LOC104924425,LOC103375901 other upstream 933012 18113110 ~ 18115097 (-)
prkra prkra other upstream 976634 18156732 ~ 18163749 (-)
G125089 dct,LOC102781940 other upstream 1515382 18695480 ~ 18699802 (-)
G125090 NA other upstream 1520789 18700887 ~ 18704677 (-)
tbl1x LOC103352926,LOC104925011,LOC102307724 other upstream 2051889 19231987 ~ 19258846 (-)

Expression



Co-expression Network