G16174


Basic Information

Item Value
gene id G16174
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053113.1
NCBI id CM020910.1
chromosome length 48524041
location 11133104 ~ 11133336 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU21939
ccagcggcataaaggtctacgaggaaactcgattgcggctggtttagacctgcttttaagaggcggagaatttcccccgcagaatagaggcgcgctcttactgacagtctttgtaaacaccacggaatatataattaggggcactttgtgcttatcctcccacctttttgggtggaactcccactttccccacgaccctcccacgaacgcatattgaaagcgcaacttgtctc

Function

GO:

id name namespace
GO:0005581 collagen trimer cellular_component

KEGG:

id description
ko04512 ECM-receptor interaction
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU21939 True 233 lncRNA 0.40 1 11133104 11133336

Neighbor

gene id symbol gene type direction distance location
si:cabz01090165.1 LOC100707198,LOC102192222 coding downstream 565713 10493115 ~ 10567391 (-)
LOC120574326 NA coding downstream 780265 10342382 ~ 10352839 (-)
LOC120551206 NA coding downstream 790446 10257611 ~ 10342658 (-)
LOC120551203 NA coding downstream 885033 10227228 ~ 10248071 (-)
zgc:162698 tmem87a,LOC101066087 coding downstream 954306 10153891 ~ 10178798 (-)
LOC120547527 LOC103361823,LOC107379843,LOC108244675 coding upstream 362836 11496172 ~ 11501340 (-)
gdpd4a LOC102208771,LOC101483676,LOC102301321,LOC100692992,LOC103373497 coding upstream 487335 11620671 ~ 11642942 (-)
pak1 pak1,LOC100698864,LOC101483196 coding upstream 566563 11699899 ~ 11793201 (-)
capn5a capn5,LOC100709916,LOC102310670,LOC106535735 coding upstream 679943 11813279 ~ 11865934 (-)
dcun1d5 LOC106964839,LOC103138233,LOC106911103,LOC103475081,LOC108248937,LOC103377933 coding upstream 754153 11887489 ~ 11906289 (-)
LOC120549056 NA non-coding downstream 30330 11092912 ~ 11102774 (-)
LOC120543595 LOC108245180 non-coding downstream 107124 11024987 ~ 11025980 (-)
G16164 NA non-coding downstream 579129 10501535 ~ 10553975 (-)
G16162 NA non-coding downstream 627772 10469815 ~ 10505332 (-)
LOC120547199 NA non-coding downstream 681991 10443726 ~ 10451113 (-)
G16175 NA non-coding upstream 38300 11171636 ~ 11171843 (-)
G16179 NA non-coding upstream 129992 11263328 ~ 11263778 (-)
G16182 NA non-coding upstream 162253 11295589 ~ 11295953 (-)
G16186 NA non-coding upstream 171907 11305243 ~ 11305561 (-)
LOC120553105 NA non-coding upstream 187124 11320460 ~ 11324418 (-)
G16143 LOC103372137,LOC102304476 other downstream 708334 10373568 ~ 10424770 (-)
LOC120574316 NA other downstream 802257 10318834 ~ 10330847 (-)
LOC120574297 NA other downstream 931520 10184003 ~ 10201584 (-)
G16064 NA other downstream 983533 10140176 ~ 10149571 (-)
G16066 NA other downstream 994757 10136688 ~ 10138347 (-)
G16407 cul5,LOC101165410,LOC108248946 other upstream 816001 11949337 ~ 11955578 (-)
G16422 NA other upstream 855682 11989018 ~ 12033762 (-)
G16458 NA other upstream 1091723 12225059 ~ 12262775 (-)
LOC120554324 NA other upstream 1353681 12487017 ~ 12487180 (-)
LOC120554526 NA other upstream 1355537 12488873 ~ 12489063 (-)

Expression


Co-expression Network