G17739



Basic Information


Item Value
gene id G17739
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053113.1
NCBI id CM020910.1
chromosome length 48524041
location 17692996 ~ 17693268 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU24290
cctcataaccactgaaaactgtcaaaaaaatctaacccaaagtccaattattatggacgttatgtgactgataactgattgatatctgattgatcattgtttaggtacattaagttaccacgttaagctttttcacgttaagcgttagaatgtcccggctgctgttgagggaaactgtagtctataacttcctgagcgactgatcgtccatttttgccccctttacataataaatatggctatgaaatggaacatgaaatacataaatgaggc

Function


GO: NA

KEGG:

id description
ko04512 ECM-receptor interaction
ko04510 Focal adhesion
ko04974 Protein digestion and absorption

RNA


RNA id representative length rna type GC content exon number start site end site
TU24290 True 273 lncRNA 0.40 1 17692996 17693268

Neighbor


gene id symbol gene type direction distance location
LOC120544259 ecel1 coding downstream 58947 17504799 ~ 17634049 (-)
tmem199 tmem199 coding downstream 462631 17227524 ~ 17230365 (-)
gemin4 NA coding downstream 530292 17155692 ~ 17162704 (-)
LOC120551331 NA coding downstream 743160 16947756 ~ 16949836 (-)
usf1 usf1 coding downstream 1028314 16655490 ~ 16664682 (-)
LOC120573061 LOC100706961,LOC103359448 coding upstream 426029 18119297 ~ 18124891 (-)
alp3 LOC103377813,LOC108248287 coding upstream 463847 18157115 ~ 18170945 (-)
psmd2 psmd2,LOC102798368 coding upstream 531244 18224512 ~ 18236516 (-)
dhrs12la LOC102209276,LOC100699243,LOC101076961 coding upstream 595019 18288287 ~ 18298760 (-)
scg2a NA coding upstream 610847 18304115 ~ 18307527 (-)
G17716 NA non-coding downstream 220050 17472679 ~ 17472946 (-)
G17714 NA non-coding downstream 225505 17465020 ~ 17467491 (-)
G17701 NA non-coding downstream 233608 17456595 ~ 17459388 (-)
G17713 NA non-coding downstream 236537 17453929 ~ 17456459 (-)
G17710 NA non-coding downstream 239069 17444392 ~ 17453927 (-)
G17745 NA non-coding upstream 62900 17756168 ~ 17756432 (-)
G17782 NA non-coding upstream 151166 17844434 ~ 17849019 (-)
G17917 farsb,LOC102796683,LOC102210931 non-coding upstream 689891 18383159 ~ 18383539 (-)
G17936 NA non-coding upstream 899707 18592975 ~ 18593673 (-)
G17964 NA non-coding upstream 1055930 18749198 ~ 18749401 (-)
xaf1 LOC107094331 other downstream 214093 17472947 ~ 17478903 (-)
G17597 NA other downstream 762002 16848161 ~ 16930994 (-)
sdhdb sdhd other downstream 1632588 16046008 ~ 16060408 (-)
G17287 NA other downstream 1973955 15695554 ~ 15719041 (-)
lyrm9 lyrm9 other downstream 2041949 15646641 ~ 15651047 (-)
LOC120552194 NA other upstream 106731 17799999 ~ 17890661 (-)
zgc:165508 fam131a,LOC102799247 other upstream 434198 18127466 ~ 18151968 (-)
LOC120545639 eif4g1 other upstream 485745 18179013 ~ 18222893 (-)
fbxo46 fbxo46,LOC102786997 other upstream 2007959 19701227 ~ 19717307 (-)
si:ch211-11n16.2 LOC104927205,LOC101481481,LOC100694251,LOC103369702,LOC107094496 other upstream 2107483 19800751 ~ 19810130 (-)

Expression



Co-expression Network