G18382



Basic Information


Item Value
gene id G18382
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053113.1
NCBI id CM020910.1
chromosome length 48524041
location 20773635 ~ 20773922 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU25140
attttgtctctagtaatttatggaattactgggggaaaaaactaaaggtacatacgtaacagtaccaaagaatagtgtgactaatcctgcctctctccagcatcatgtggcaagttttcttcatcacattggatgtctgcatcatctctaaatacaaatgaatgtggtgtttctattgctttcacctccattactttctgaaaaacagtaagaatgcagttttactattgtaaagatatagtgtttttcacttttttttatagctgtgtatataacctcagacatctt

Function


GO: NA

KEGG:

id description
ko00120 Primary bile acid biosynthesis
ko04146 Peroxisome
ko04610 Complement and coagulation cascades

RNA


RNA id representative length rna type GC content exon number start site end site
TU25140 True 288 lncRNA 0.57 1 20773635 20773922

Neighbor


gene id symbol gene type direction distance location
sidt2 sidt2 coding downstream 695492 20059933 ~ 20078143 (-)
LOC120550021 NA coding downstream 742847 20028341 ~ 20030788 (-)
LOC120550005 tbx10,LOC104965412 coding downstream 745838 20023847 ~ 20027797 (-)
bace1 bace1,LOC102782465 coding downstream 750280 20011130 ~ 20023355 (-)
pcsk7 pcsk7 coding downstream 764454 19990719 ~ 20009181 (-)
igsf11 igsf11,LOC102790613 coding upstream 189918 20963840 ~ 21080775 (-)
LOC120573880 NA coding upstream 324018 21097940 ~ 21108764 (-)
git1 git1,LOC102788862 coding upstream 347942 21121864 ~ 21151383 (-)
ssh2a ssh2,ssh2a coding upstream 421466 21195388 ~ 21227407 (-)
blmh blmh coding upstream 493782 21267704 ~ 21290294 (-)
G18381 NA non-coding downstream 66850 20706521 ~ 20706785 (-)
G18366 NA non-coding downstream 515580 20184811 ~ 20258055 (-)
G18367 gap43 non-coding downstream 567947 20192880 ~ 20205688 (-)
G18337 NA non-coding downstream 654029 20116285 ~ 20119606 (-)
G18329 cep164 non-coding downstream 719501 20053220 ~ 20054134 (-)
G18385 NA non-coding upstream 113884 20887806 ~ 20888029 (-)
G18391 NA non-coding upstream 163071 20936993 ~ 20937249 (-)
LOC120575525 NA non-coding upstream 311171 21085093 ~ 21086875 (-)
G18429 NA non-coding upstream 339450 21113372 ~ 21115994 (-)
G18492 NA non-coding upstream 636986 21410908 ~ 21411199 (-)
LOC120547993 NA other downstream 632097 20137072 ~ 20141538 (-)
si:ch211-11n16.2 LOC104927205,LOC101481481,LOC100694251,LOC103369702,LOC107094496 other downstream 963505 19800751 ~ 19810130 (-)
fbxo46 fbxo46,LOC102786997 other downstream 1056328 19701227 ~ 19717307 (-)
LOC120545639 eif4g1 other downstream 2550742 18179013 ~ 18222893 (-)
zgc:165508 fam131a,LOC102799247 other downstream 2621667 18127466 ~ 18151968 (-)
si:ch1073-340i21.1 NA other upstream 320255 21094177 ~ 21097201 (-)
slc6a4a slc6a4,LOC103359260,LOC108228506 other upstream 463266 21237188 ~ 21261923 (-)
LOC120572205 NA other upstream 836892 21610814 ~ 21615246 (-)
gdpd5b gdpd5,LOC103357216 other upstream 890154 21664076 ~ 21710363 (-)
LOC120551419 LOC100709410,LOC102313657,LOC102784399,LOC102206705,LOC101487802,LOC104941978 other upstream 1209380 21983302 ~ 22007175 (-)

Expression



Co-expression Network