G20458


Basic Information

Item Value
gene id G20458
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053113.1
NCBI id CM020910.1
chromosome length 48524041
location 29593404 ~ 29598747 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU27822
CTGCAGGTCAAATGGCTCCGTTCCAGGTGCCTGGATCTTAACAGTGAAGCCCGTGTCCTGGATCACTATCACTTCCTGTTCGTTAGACTCCTCTCCTCCATCCGTCTCACTGTTCCCATCCTGCTTGGATTCTGCCTCCTCTGTGCGCTCATGAGCCCCATCACCATTCACCATGGCTGTATCTGCACTGTGCCCAGCTTACACGGCTGCTCGTGTATTATTAGCGTAACCTTCCCTCTCACTGTGCATGCGCCATCGTGAC

Function

GO:

id name namespace
GO:0006913 nucleocytoplasmic transport biological_process
GO:0051169 nuclear transport biological_process
GO:0046907 intracellular transport biological_process
GO:0051649 establishment of localization in cell biological_process

KEGG:

id description
ko03013 Nucleocytoplasmic transport
ko03008 Ribosome biogenesis in eukaryotes
ko03030 DNA replication
ko03430 Mismatch repair
ko04110 Cell cycle
ko04111 Cell cycle - yeast
ko04113 Meiosis - yeast

RNA

RNA id representative length rna type GC content exon number start site end site
TU27822 True 262 lncRNA 0.39 2 29593404 29598747

Neighbor

gene id symbol gene type direction distance location
aifm4 LOC104966742 coding downstream 67082 29519140 ~ 29526322 (-)
trnaw-cca NA coding downstream 80684 29512649 ~ 29512720 (-)
prpf8 prpf8 coding downstream 85025 29491164 ~ 29508379 (-)
LOC120545703 rilp,LOC104966718 coding downstream 102760 29477893 ~ 29490644 (-)
LOC120545693 scarf1 coding downstream 115850 29469093 ~ 29477554 (-)
sept4b LOC103353393,LOC102798639,LOC102292831,LOC102194568,LOC101473185 coding upstream 121269 29720016 ~ 29771339 (-)
limk1a limk1,LOC100693040,LOC102194872,LOC101472506,LOC102798153,LOC102292112 coding upstream 176778 29775525 ~ 29829377 (-)
elna NA coding upstream 231740 29830487 ~ 29889063 (-)
psph psph,LOC102797258 coding upstream 346486 29945233 ~ 29951475 (-)
LOC120575091 phkg1 coding upstream 356759 29955506 ~ 29963599 (-)
G20431 NA non-coding downstream 39836 29553314 ~ 29553568 (-)
G20425 tlcd2,LOC107103571,LOC104967200 non-coding downstream 40304 29532566 ~ 29553100 (-)
G20408 NA non-coding downstream 124517 29443337 ~ 29468887 (-)
G20407 NA non-coding downstream 159398 29433055 ~ 29434006 (-)
G20350 unc119 non-coding downstream 211113 29362929 ~ 29382291 (-)
G20463 NA non-coding upstream 6092 29604839 ~ 29606154 (-)
G20480 pafah1b1,LOC106581047 non-coding upstream 54396 29653143 ~ 29656085 (-)
G20482 NA non-coding upstream 62800 29661547 ~ 29662779 (-)
G20526 NA non-coding upstream 94459 29693206 ~ 29693461 (-)
G20541 NA non-coding upstream 309430 29908177 ~ 29908403 (-)
G20417 scarf1 other downstream 144749 29447170 ~ 29448655 (-)
cwf19l2 cwf19l2 other downstream 1745856 27824605 ~ 27847548 (-)
G19840 NA other downstream 2504340 27088606 ~ 27089064 (-)
cul3b cul3,LOC104924156,LOC100710156,LOC107099750,LOC108240497,LOC104940878,LOC103474461,LOC108428259,LOC102194569,LOC101170875 other downstream 3123508 26451380 ~ 26469896 (-)
LOC120570434 fam124b other downstream 3147469 26434281 ~ 26445935 (-)
im:7138535 NA other upstream 368682 29967429 ~ 29972350 (-)
rnf26 rnf26 other upstream 488988 30087735 ~ 30091711 (-)
cbl cbl other upstream 556146 30154893 ~ 30198071 (-)
arhgef12a arhgef12 other upstream 970126 30568873 ~ 30618434 (-)
spa17 spa17,LOC103353395,LOC106919647,LOC107380342,LOC100697535 other upstream 1087464 30686211 ~ 30696629 (-)

Expression


Co-expression Network