G22917 (grik1,LOC104963619,LOC107585794,LOC102776120,LOC103378149)


Basic Information

Item Value
gene id G22917
gene name grik1,LOC104963619,LOC107585794,LOC102776120,LOC103378149
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053113.1
NCBI id CM020910.1
chromosome length 48524041
location 40239332 ~ 40240348 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU31115
GGGTTACAGGGGTGAGGGTTGTACCACTCATAGGGAGTGAATCTGGCAATAACAAACAGCACACAGCTGACACCGAGGCATGCCAGTAGCACATACATCCAGATATCAGGAGACAGTGGGTTGAGGAAGGAGAACACCCCTGGATTGGTGCCGTTGGGTTTGTGGTAGAGGATGCTGATCCCTAGCGTCATGAAGGGCTTGGAGAAATCGATCACCTTTTCCCTTACATATGTGATAGTAAGAGGGGCCACGGCCAGGTCAGCCACCTGGTACAGAACAAAAACATCAAGCAGGGCCACAGTCAAAAACAGATGATACTGCTGATCCTTCCGATAATCTCTCACATAATATTGATTGGTACTCAC

Function

symbol description
grik1 Enables kainate selective glutamate receptor activity. Predicted to be involved in glutamatergic synaptic transmission and modulation of chemical synaptic transmission. Predicted to act upstream of or within several processes, including chemical synaptic transmission; modulation of chemical synaptic transmission; and positive regulation of gamma-aminobutyric acid secretion. Predicted to be located in dendrite; postsynaptic density; and presynaptic membrane. Predicted to be part of kainate selective glutamate receptor complex. Predicted to be active in glutamatergic synapse and postsynaptic membrane. Predicted to be integral component of presynaptic membrane. Implicated in childhood absence epilepsy.

NR:

description
PREDICTED: glutamate receptor ionotropic, kainate 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU31115 True 365 lncRNA 0.49 2 40239332 40240348

Neighbor

gene id symbol gene type direction distance location
LOC120546558 LOC103363424,LOC104943694 coding downstream 326572 39904112 ~ 39912760 (-)
LOC120546419 LOC104923287,LOC104947775,LOC103363426,LOC101479268 coding downstream 337885 39868408 ~ 39901447 (-)
LOC120546408 NA coding downstream 338081 39892209 ~ 39901251 (-)
LOC120546381 LOC103363428,LOC101062185,LOC102204297 coding downstream 461412 39759961 ~ 39777920 (-)
LOC120546392 NA coding downstream 482754 39735716 ~ 39756578 (-)
usp16 NA coding upstream 20012 40260360 ~ 40268274 (-)
stoml3a stoml3,LOC104925222,LOC101073007,LOC105935001 coding upstream 584405 40824753 ~ 40832594 (-)
slc25a15a slc25a15,LOC103152068,LOC106945435,LOC103475195 coding upstream 595320 40835668 ~ 40844838 (-)
cog6 cog6,LOC102796367 coding upstream 683677 40924025 ~ 40955064 (-)
trnak-uuu_7 NA coding upstream 791458 41031806 ~ 41031878 (-)
LOC120544464 NA non-coding downstream 13013 40184747 ~ 40226319 (-)
G22826 NA non-coding downstream 314881 39924213 ~ 39924451 (-)
G22811 LOC104947776 non-coding downstream 371845 39864821 ~ 39867487 (-)
G22818 NA non-coding downstream 381546 39857436 ~ 39857786 (-)
G22816 LOC101479746,LOC102301626,LOC102203644,LOC100692726,LOC102798843 non-coding downstream 384738 39854280 ~ 39854594 (-)
G22918 grik1,LOC102307112 non-coding upstream 1235 40241583 ~ 40244030 (-)
G22919 NA non-coding upstream 6873 40247221 ~ 40248092 (-)
G22936 NA non-coding upstream 47290 40287638 ~ 40287869 (-)
G22962 NA non-coding upstream 151000 40391348 ~ 40489408 (-)
LOC120545373 NA non-coding upstream 285221 40525569 ~ 40561333 (-)
LOC120546248 LOC103363423,LOC101478053,LOC102201911,LOC102303851 other downstream 206176 39943571 ~ 40033156 (-)
LOC120570635 sel1l3,LOC103353588 other downstream 1503509 38727508 ~ 38735823 (-)
robo2 NA other downstream 1590733 38353024 ~ 38648599 (-)
p4ha3 p4ha3 other downstream 2493050 37732841 ~ 37746282 (-)
LOC120571840 LOC103356713,LOC100701072,LOC102300918,LOC101484608,LOC102193268 other downstream 2541193 37692438 ~ 37698139 (-)
cadm2b cadm2,LOC100695412,LOC103378151,LOC106520568,LOC102793287 other upstream 49657 40290005 ~ 40470176 (-)
cntn5 NA other upstream 1789325 42029673 ~ 42167037 (-)
LOC120574039 nlk,nlk2 other upstream 2996334 43236682 ~ 43346673 (-)
LOC120553425 NA other upstream 3460623 43700971 ~ 43716741 (-)
smco4 NA other upstream 3529718 43770066 ~ 43789435 (-)

Expression


Co-expression Network