LOC120548779 (coq8b,LOC103364879,LOC107395920,LOC108247334)


Basic Information

Item Value
gene id LOC120548779
gene name coq8b,LOC103364879,LOC107395920,LOC108247334
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053113.1
NCBI id CM020910.1
chromosome length 48524041
location 19754887 ~ 19755993 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>XR_005637280.1
GCCATGGAGCTTGTACATGGAGTTCCACTGGACCGCTGCGTAGACCTGGACCAGGAGACTAGGAACCAGATCAGTTTCAGAATCCTCCAGTTGTGTCTCAGGGAGGTGTTTGAGTTCAGGTTCATGCAGACGGATCCAAACTGGGCCAACTTCTTCTACAACTCAGACACCAACAAGGTTGTTCTGTTGGACTTTGGGGCGTGCAGAGGCTACCCAGAAGCATTCACAGATGACTACATACAGGTATGATAAATCTAAAATGATAGGAC

Function

symbol description
coq8b Predicted to enable kinase activity. Acts upstream of or within glomerular basement membrane development and glomerular visceral epithelial cell development. Predicted to be located in cytosol; mitochondrion; and plasma membrane. Predicted to be integral component of membrane. Predicted to be extrinsic component of mitochondrial inner membrane. Human ortholog(s) of this gene implicated in nephrotic syndrome type 9. Orthologous to human COQ8B (coenzyme Q8B).

NR:

description
PREDICTED: aarF domain-containing protein kinase 4-like isoform X2

GO:

id name namespace
GO:0008152 metabolic process biological_process
GO:0016772 transferase activity, transferring phosphorus-containing groups molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_005637280.1 True 269 lncRNA 0.49 3 19754887 19755993

Neighbor

gene id symbol gene type direction distance location
sars2 sars2,LOC102787987 coding downstream 73867 19671088 ~ 19681020 (-)
LOC120545125 LOC106935408,LOC103155939,LOC106914189,LOC103474854,LOC102218288 coding downstream 84316 19663258 ~ 19670571 (-)
psma6l LOC107094495,LOC106935416,LOC103474855,LOC103155941,LOC100701743,LOC106914191,LOC102789735 coding downstream 101063 19650041 ~ 19653824 (-)
LOC120552636 LOC107395012,LOC103364872,LOC101485936 coding downstream 117485 19633493 ~ 19637402 (-)
nop53 NA coding downstream 145866 19598150 ~ 19609021 (-)
LOC120575197 NA coding upstream 116486 19872479 ~ 19891955 (-)
LOC120575210 tcaf2 coding upstream 136549 19892542 ~ 19906151 (-)
LOC120575221 NA coding upstream 158130 19914123 ~ 19925101 (-)
si:ch1073-280e3.1 NA coding upstream 177500 19933493 ~ 19940419 (-)
nudt8 LOC107720444 coding upstream 193225 19949218 ~ 19953810 (-)
G18184 NA non-coding downstream 105235 19649216 ~ 19649652 (-)
G18179 NA non-coding downstream 126247 19625403 ~ 19628640 (-)
G18155 NA non-coding downstream 212216 19456213 ~ 19542671 (-)
LOC120573122 NA non-coding downstream 213757 19538375 ~ 19541130 (-)
G18127 NA non-coding downstream 349526 19383403 ~ 19405361 (-)
G18216 NA non-coding upstream 95911 19851904 ~ 19856310 (-)
G18329 cep164 non-coding upstream 297227 20053220 ~ 20054134 (-)
G18337 NA non-coding upstream 360292 20116285 ~ 20119606 (-)
G18366 NA non-coding upstream 428818 20184811 ~ 20258055 (-)
G18367 gap43 non-coding upstream 436887 20192880 ~ 20205688 (-)
fbxo46 fbxo46,LOC102786997 other downstream 37580 19701227 ~ 19717307 (-)
LOC120545639 eif4g1 other downstream 1531994 18179013 ~ 18222893 (-)
zgc:165508 fam131a,LOC102799247 other downstream 1602919 18127466 ~ 18151968 (-)
LOC120552194 NA other downstream 1864226 17799999 ~ 17890661 (-)
xaf1 LOC107094331 other downstream 2275984 17472947 ~ 17478903 (-)
si:ch211-11n16.2 LOC104927205,LOC101481481,LOC100694251,LOC103369702,LOC107094496 other upstream 44758 19800751 ~ 19810130 (-)
LOC120547993 NA other upstream 381079 20137072 ~ 20141538 (-)
si:ch1073-340i21.1 NA other upstream 1338184 21094177 ~ 21097201 (-)
slc6a4a slc6a4,LOC103359260,LOC108228506 other upstream 1481195 21237188 ~ 21261923 (-)
LOC120572205 NA other upstream 1854821 21610814 ~ 21615246 (-)

Expression


Co-expression Network