G151203


Basic Information

Item Value
gene id G151203
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053126.1
NCBI id CM020923.1
chromosome length 38831509
location 2715669 ~ 2716220 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU204861
tctttacctaaacccaaccgtcccgttcttctttacctaaacccaaccgtcccgttcttctttacctaaacccaaccgtcccgttcttctttacctaaacccaactgtcccgttcttctttatctaaacccaactgtcccgttcttctttacctaaacccaactgtcccgttcttctttacctaaacccaactgtcccgttcttctttacctaaacccaactgtcccgttcttctttacctaaacccaactgtcctgttcttctttacctaaacccaactgtcccgttcttctttacctaaacccaaccgtcccgttcttcttttcctaaacccaactgtcccgttcttctttacctaaatccaactgtccc
>TU204863
tctttacctaaacccaaccgtcccgttcttctttacctaaacccaaccgtcccgttcttctttacctaaacccaaccgtcccgttcttctttacctaaacccaaccgtcccgttcttctttacctaaacccaaccgtcccgttcttctttacctaaacccaaccgtcccgttcttctttacctaaacccaaccgtcccgttcttcttttcctaaacccaactgtcccgttcttctttacctaaatccaactgtccc

Function

GO:

id name namespace
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU204861 True 372 lncRNA 0.45 2 2715669 2716220
TU204863 False 256 lncRNA 0.47 2 2715669 2716220

Neighbor

gene id symbol gene type direction distance location
pglyrp6 NA coding downstream 265200 2438102 ~ 2450469 (-)
si:ch211-194b1.1 wiz,LOC107731472 coding downstream 282449 2355442 ~ 2433220 (-)
LOC120573916 LOC103358683,LOC104942087,LOC104930238,LOC103393647 coding downstream 490701 2214594 ~ 2224968 (-)
ilf3b ilf3,LOC102795819 coding downstream 506412 2164720 ~ 2209257 (-)
LOC120574768 LOC103358687,LOC104930242 coding downstream 657030 2004876 ~ 2058639 (-)
LOC120574080 gfi1,LOC102083319,LOC102796239,LOC103376798,LOC101077887 coding upstream 21715 2737935 ~ 2750253 (-)
si:ch211-106h11.3 LOC103375031 coding upstream 85162 2801382 ~ 2820321 (-)
LOC120574018 NA coding upstream 124213 2840433 ~ 2842813 (-)
trir csgr03h19orf43,clg4h19orf43,LOC103154935,LOC107087651,LOC103376077,LOC102224489 coding upstream 283430 2999650 ~ 3003392 (-)
hook2 LOC103364969 coding upstream 291869 3008089 ~ 3035012 (-)
G151200 NA non-coding downstream 38600 2676597 ~ 2677069 (-)
G151170 NA non-coding downstream 134175 2483290 ~ 2581494 (-)
G151181 NA non-coding downstream 147510 2567787 ~ 2568159 (-)
G151179 NA non-coding downstream 148066 2547715 ~ 2567603 (-)
G151177 NA non-coding downstream 198653 2516737 ~ 2517016 (-)
G151210 NA non-coding upstream 28276 2744496 ~ 2745709 (-)
G151195 NA non-coding upstream 226061 2942281 ~ 2944617 (-)
G151261 NA non-coding upstream 232865 2949085 ~ 2949619 (-)
G151275 NA non-coding upstream 253734 2969954 ~ 2970309 (-)
G151282 NA non-coding upstream 269873 2986093 ~ 2986852 (-)
farsa farsa other downstream 553945 2132732 ~ 2161724 (-)
LOC120573864 NA other downstream 843577 1845740 ~ 1872092 (-)
LOC120573867 LOC108236047,LOC107376309,LOC101475947,LOC100695382,LOC106520692,LOC105918010 other downstream 893541 1816065 ~ 1822128 (-)
G150856 NA other downstream 976188 1724122 ~ 1739481 (-)
LOC120574287 col1,LOC108233705,LOC103393603,LOC106536191 other downstream 1095198 1606215 ~ 1620471 (-)
G151216 LOC106957010,LOC107376217,LOC103393680 other upstream 157698 2873918 ~ 2896343 (-)
G151227 LOC103393680 other upstream 195106 2911326 ~ 2915367 (-)
G151344 smarca4 other upstream 595507 3311727 ~ 3316915 (-)
LOC120575464 NA other upstream 1645628 4361848 ~ 4367343 (-)
LOC120575466 LOC102292836,LOC101471904,LOC100692969,LOC103393382,LOC103468414,LOC102212070,LOC103143659,LOC102784177 other upstream 1699957 4416177 ~ 4464991 (-)

Expression


Co-expression Network