G153130 (atp2a1)


Basic Information

Item Value
gene id G153130
gene name atp2a1
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053126.1
NCBI id CM020923.1
chromosome length 38831509
location 8612277 ~ 8616112 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU207421
TTTGGCAGATTTGGCAGGACAGCAGTAAACTGACATGGACTTTCTGTCTCTGGAGAACTCCAGGGTGAACTCCTTCTTCATCAGCTGCTTGATCACAGAACAGCAAGCATTTGCCCTTTCCACCTTGGACAGGCCACGCACTTCACTGTTGAACACGTTCATCTTCTCCACCAGACAGGACAGTGCTGTTTCAGTGGCCTCGCCCACTTTTTCATAAATACCCTTGGACTCGTTGTAGTCCAGGGAAGAGTCATTGCAAAGAGCGCAGATGGTAGCCAGCTCGACCAGTCCGTCATACTGACCGCACTTCGTTAATGAGCCATTCTTTGTAACTTCTCCCTCGGGGGTGTACTTTGAGCCTGAGATGTCAAACTGGCTGAGGGAAACATTGTCACCATCGACTTTATCAATGATGAACATCTTAGTTACACACATCTGGTTGGTGGTGAGGGTACCGGTCTTGTCAGAGCAGATGACCGAGGTGCAGCCCAGGGTCTCCACGGAGGGCAGGCTTCTGACGATGGCGTTCTTCTTGGCCATGCGGCGGGTTCCCAGAGCCAGGCAGGTTGTGATGACAGCAGGCAGACCTTCAGGGATGGCAGCCACAGCCAGAGCCACAGCAATCTTGAAATAGTAGAC

Function

symbol description
atp2a1 Predicted to enable ATP binding activity; P-type calcium transporter activity; and calcium ion binding activity. Acts upstream of or within several processes, including cellular calcium ion homeostasis; negative regulation of muscle contraction; and relaxation of skeletal muscle. Predicted to be located in several cellular components, including endoplasmic reticulum; endoplasmic reticulum-Golgi intermediate compartment; and sarcomere. Predicted to be active in sarcoplasmic reticulum membrane. Predicted to be integral component of membrane. Is expressed in several structures, including eye; gill; mesoderm; musculature system; and pectoral fin. Used to study Brody myopathy. Human ortholog(s) of this gene implicated in Brody myopathy. Orthologous to human ATP2A1 (ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 1).

NR:

description
PREDICTED: sarcoplasmic/endoplasmic reticulum calcium ATPase 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU207421 True 639 lncRNA 0.52 6 8612277 8616112

Neighbor

gene id symbol gene type direction distance location
LOC120573875 LOC104929518,LOC103375462,LOC108242957 coding downstream 91690 8513629 ~ 8520587 (-)
LOC120575363 LOC103375241,LOC104929519,LOC102212394,LOC101477022,LOC102794201,LOC102305637 coding downstream 100437 8506317 ~ 8511840 (-)
recql5 recql5,LOC102306769 coding downstream 107438 8488379 ~ 8504839 (-)
cdr2l LOC100699057 coding downstream 127585 8474480 ~ 8484692 (-)
nptx1l LOC103375324,LOC104929529,LOC100699861 coding downstream 310006 8297738 ~ 8302271 (-)
rabep2 rabep2 coding upstream 10971 8627083 ~ 8640435 (-)
si:ch211-11k18.4 LOC101474882,LOC102302894 coding upstream 35520 8651632 ~ 8659219 (-)
nudt9 nudt9 coding upstream 44190 8660302 ~ 8665654 (-)
mapk8ip3 mapk8ip3 coding upstream 123519 8739631 ~ 8768700 (-)
jpt2 hn1l coding upstream 156752 8772864 ~ 8778762 (-)
G153127 atp2a1,LOC102238060,LOC106906942,LOC103469116 non-coding downstream 280 8551296 ~ 8611997 (-)
G153124 NA non-coding downstream 24089 8540378 ~ 8588188 (-)
G153111 arhgdia,LOC100706235,LOC107087451 non-coding downstream 53365 8463179 ~ 8558912 (-)
G153116 NA non-coding downstream 74321 8490056 ~ 8537956 (-)
G153112 NA non-coding downstream 141984 8468304 ~ 8470293 (-)
G153142 NA non-coding upstream 28672 8644784 ~ 8645025 (-)
G153143 NA non-coding upstream 30971 8647083 ~ 8647291 (-)
G153139 NA non-coding upstream 43499 8659611 ~ 8684753 (-)
G153137 NA non-coding upstream 83997 8700109 ~ 8776266 (-)
G153274 NA non-coding upstream 445184 9061296 ~ 9111224 (-)
G152952 NA other downstream 167896 8441179 ~ 8444381 (-)
LOC120574885 LOC103375378,LOC104925605,LOC104966930 other downstream 511879 8082138 ~ 8100398 (-)
grin2aa grin2a,LOC102780805 other downstream 888363 7569718 ~ 7723914 (-)
arhgdig NA other downstream 1810741 6772880 ~ 6801536 (-)
G152567 NA other downstream 1891634 6719784 ~ 6720643 (-)
G153172 mrps34,LOC102799846 other upstream 115285 8731397 ~ 8733019 (-)
natd1 natd1 other upstream 196218 8812330 ~ 8816305 (-)
tufm tufm,LOC106606342,LOC101070424,LOC106606341,LOC106931188,LOC103145412 other upstream 234331 8850443 ~ 8857571 (-)
zgc:55558 p-ras,LOC105029053,LOC104950842,LOC104930345,LOC103392975,LOC101069736,LOC106606379,LOC103023536,LOC108413997 other upstream 279670 8895782 ~ 8907662 (-)
LOC120574599 NA other upstream 571138 9187250 ~ 9204006 (-)

Expression


Co-expression Network