G154036


Basic Information

Item Value
gene id G154036
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053126.1
NCBI id CM020923.1
chromosome length 38831509
location 11271819 ~ 11272848 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU208730
GGCATCATTGTGTGCTTCCTCATATGGATCATCCTTAAGACCAAAACTACCAAAAGGCGCACCAAAATGAAACCGAGGAACGTCACCAACAATGATGTTTATGAGGACATGCGTGGAACAATCAGACGCTAAAGATGTCAGCCTGCACGCAAGCAACCTGAAACTCCACCATCTCTCTGCACCACTAAGATGCAAGTTATGCATGAGGAGCAATGTTGCAACTCAGCATATTCTCTGTAATCTATTCTGGCCCTCTGTGTGTC

Function

GO: NA

KEGG:

id description
ko04640 Hematopoietic cell lineage
ko04612 Antigen processing and presentation
ko04672 Intestinal immune network for IgA production
ko05150 Staphylococcus aureus infection
ko05310 Asthma
ko05320 Autoimmune thyroid disease
ko05321 Inflammatory bowel disease
ko05330 Allograft rejection
ko05332 Graft-versus-host disease
ko04940 Type I diabetes mellitus

RNA

RNA id representative length rna type GC content exon number start site end site
TU208730 True 263 lncRNA 0.46 2 11271819 11272848

Neighbor

gene id symbol gene type direction distance location
LOC120574065 NA coding downstream 8098 11172521 ~ 11263721 (-)
LOC120574485 NA coding downstream 187246 11081719 ~ 11084573 (-)
c15h17orf75 clg4h17orf75,clg8h17orf75,LOC102789701,LOC101467397,LOC102229770,LOC106934014,LOC106960136 coding downstream 207969 11057892 ~ 11063850 (-)
LOC120574053 LOC104934592,LOC103360693 coding downstream 255228 11008642 ~ 11016591 (-)
rln3a LOC104944611,LOC103360695 coding downstream 277789 10988167 ~ 10994030 (-)
LOC120573949 NA coding upstream 17018 11289866 ~ 11293711 (-)
LOC120573873 hn1 coding upstream 26359 11299207 ~ 11309655 (-)
LOC120573874 sumo2 coding upstream 37830 11310678 ~ 11318550 (-)
gga3b gga3 coding upstream 55421 11328269 ~ 11338111 (-)
mif4gdb mif4gd coding upstream 68409 11341257 ~ 11347860 (-)
G153987 NA non-coding downstream 198043 11069043 ~ 11073776 (-)
G153943 LOC104934589,LOC102791985 non-coding downstream 236303 11033206 ~ 11035516 (-)
G153950 NA non-coding downstream 312298 10950571 ~ 10959521 (-)
G153937 NA non-coding downstream 364211 10905355 ~ 10907608 (-)
G153734 NA non-coding downstream 676812 10594743 ~ 10595007 (-)
G154088 NA non-coding upstream 79355 11352203 ~ 11352565 (-)
G154115 NA non-coding upstream 194060 11466908 ~ 11467112 (-)
G154163 bri3,LOC104946088,LOC103141671 non-coding upstream 256848 11529696 ~ 11557733 (-)
G154173 NA non-coding upstream 367180 11640028 ~ 11641512 (-)
G154175 NA non-coding upstream 370269 11643117 ~ 11649924 (-)
G154033 NA other downstream 46273 11203450 ~ 11225546 (-)
tnrc6c1 LOC103361861 other downstream 134291 11098316 ~ 11137528 (-)
LOC120574486 NA other downstream 191212 11078545 ~ 11080607 (-)
LOC120574455 NA other downstream 480254 10784112 ~ 10791565 (-)
gtpbp1 gtpbp1,LOC104924447,LOC102799794 other downstream 881643 10352158 ~ 10390176 (-)
LOC120574419 NA other upstream 813137 12085985 ~ 12090981 (-)
cep112 NA other upstream 1154656 12427504 ~ 12565471 (-)
LOC120575506 LOC100697827 other upstream 1462596 12735444 ~ 12737483 (-)
iqck NA other upstream 1682126 12954974 ~ 12972829 (-)
sun1 sun1,LOC104947709,LOC102193096,LOC103360714 other upstream 1700412 12973260 ~ 13012781 (-)

Expression


Co-expression Network