G155242 (hgs)


Basic Information

Item Value
gene id G155242
gene name hgs
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053126.1
NCBI id CM020923.1
chromosome length 38831509
location 15554043 ~ 15554886 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU210400
GGGGCAGCACTGGGCATGGCCTGGTACTGTGGTGGTGCAGTCTGCCCAGGCGGGTTCATATAGATGTTGTGCATAGGTGAACCCTCCACAGAACCAGCAGGACTGAAGGTGCCTGGATAGCTCGGTGGAGCACCAGGCTGGTACACCACCCCTCCTGCCACATTGGGGGGCAAAGACTGCATCTGGGCGTAAGGCAGCGAGAAAGCAGGCATTTGGGCTCTCATCTGGACTGTGTGTTTCTGCTGCTCCAGACGCATCTGCCTTTCCTTTTCCTGCTCCTGGAGGCGCTGGATGGCCAGCTGTCGTTGCATCTCCAGGTACTCCTGTTTCTTCTGCCTCATGATCTCCAGTTTTTGTGCCAGCTGGATCTGCCTCTGTCTCTCCGCTTCCTCTGCAGCGCGACGCAGCTTCTCTCTGTGTTCGTCCCGAAGTGCGTTGAGGGCTGCCCGAGCATCACGCACCTGAGCCAACTTGTCCTGCAGCCCTTCATAG

Function

symbol description
hgs Predicted to enable kinase activity and metal ion binding activity. Predicted to act upstream of or within intracellular protein transport and phosphorylation. Predicted to be located in early endosome membrane. Orthologous to human HGS (hepatocyte growth factor-regulated tyrosine kinase substrate).

NR:

description
PREDICTED: hepatocyte growth factor-regulated tyrosine kinase substrate isoform X6

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU210400 True 492 lncRNA 0.58 3 15554043 15554886

Neighbor

gene id symbol gene type direction distance location
rsad1 rsad1,LOC102775824 coding downstream 19517 15530445 ~ 15534526 (-)
epn3a epn3 coding downstream 31534 15512352 ~ 15522509 (-)
LOC120573957 LOC104960327,LOC108241277,LOC101068065,LOC104918611,LOC102777936 coding downstream 44079 15507726 ~ 15509964 (-)
tbcd NA coding downstream 48589 15476359 ~ 15505454 (-)
LOC120573906 acsf2,LOC102294907 coding downstream 129840 15417045 ~ 15424203 (-)
zgc:103625 LOC104960319,LOC103356288,LOC100689735 coding upstream 2194 15557080 ~ 15558737 (-)
trnae-cuc_25 NA coding upstream 9247 15564133 ~ 15564204 (-)
gcgra LOC103367158 coding upstream 50617 15605503 ~ 15645622 (-)
LOC120574497 LOC104960315,LOC103367159 coding upstream 107388 15662274 ~ 15664597 (-)
crb3a crb3 coding upstream 115279 15670165 ~ 15673455 (-)
G155234 LOC106925874,LOC103468796,LOC106529779,LOC106946608 non-coding downstream 10026 15541557 ~ 15544017 (-)
G155232 LOC104918633,LOC103356299,LOC102214648,LOC102291995,LOC101464722,LOC100701808 non-coding downstream 26438 15526949 ~ 15527605 (-)
G155151 NA non-coding downstream 149474 15368229 ~ 15404569 (-)
G155126 NA non-coding downstream 240451 15312080 ~ 15313592 (-)
G155106 NA non-coding downstream 391608 15156429 ~ 15162435 (-)
G155295 NA non-coding upstream 127483 15682369 ~ 15691652 (-)
G155298 LOC108429687,LOC105910964,LOC100700452,LOC104918597,LOC103367163,LOC101470440 non-coding upstream 139887 15694773 ~ 15695558 (-)
G155307 LOC104918593,LOC104960307,LOC103367166 non-coding upstream 174047 15728933 ~ 15774308 (-)
LOC120574547 NA non-coding upstream 268105 15822991 ~ 15825654 (-)
G155359 NA non-coding upstream 336135 15891021 ~ 15891931 (-)
metrnla metrnl,LOC102778978 other downstream 104526 15443124 ~ 15449517 (-)
LOC120574278 LOC104940298,LOC103361237,LOC102197797,LOC102781856,LOC104946382 other downstream 414190 15106757 ~ 15139853 (-)
LOC120573850 LOC106674513,LOC106098575 other downstream 543703 15009798 ~ 15010340 (-)
LOC120573849 LOC106675063,LOC102783976,LOC102313472,LOC102290019,LOC102295680 other downstream 545331 15003013 ~ 15008712 (-)
ush1ga LOC104944226,LOC103373181,LOC103392806,LOC106949104,LOC104925058,LOC103140944 other downstream 664561 14879627 ~ 14889482 (-)
tecra LOC103367165,LOC101076261,LOC106932487,LOC104960308,LOC108241336,LOC106529633,LOC103151989 other upstream 162961 15717847 ~ 15724422 (-)
LOC120574537 NA other upstream 186877 15741763 ~ 15745572 (-)
LOC120574502 LOC103367168,LOC100699371,LOC108241234,LOC101473146,LOC106529605 other upstream 191905 15746791 ~ 15788515 (-)
G155323 LOC108415010,LOC101162128,LOC104945817 other upstream 258172 15813058 ~ 15815369 (-)
LOC120574545 chchd5 other upstream 598901 16153787 ~ 16156067 (-)

Expression


Co-expression Network