G156684 (plcd3)



Basic Information


Item Value
gene id G156684
gene name plcd3
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053126.1
NCBI id CM020923.1
chromosome length 38831509
location 20323909 ~ 20324231 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU212371
CTAAATTACGTGGTATCACATCAGTGCATATTTGAGGTAGTTTGGGAGGGTTTAGAGTAGTCAACCAATCCAAATTTCCTGTAACACTTTTACACAATAGGTTACCGCTACTCACTCGTATTGTCAGCTGGGTGGGAATGTGACCGGGTCCTCCTCCCGTATTCTCTGGGTTAAAGTCGGAAGTGGGGCTGCACAGGAAGCCCGGTTTGAGAATGTATCCACAGCGACCATTGTGGAGGAAGCGACCCTGGTTCAGGTCCATTTGCTCCCCGGGTGTCTGGAAGTTCAAAG

Function


symbol description
plcd3 Predicted to enable phosphatidylinositol phospholipase C activity. Predicted to be involved in phosphatidylinositol-mediated signaling. Predicted to act upstream of or within angiogenesis; labyrinthine layer blood vessel development; and regulation of cell population proliferation. Predicted to be located in plasma membrane.

NR:

description
PREDICTED: 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase delta-3-A

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU212371 True 291 lncRNA 0.49 2 20323909 20324231

Neighbor


gene id symbol gene type direction distance location
trnac-gca_27 NA coding downstream 152551 20171287 ~ 20171358 (-)
rpl19 rpl19,LOC107084780,LOC103371192 coding downstream 197940 20122436 ~ 20125969 (-)
st8sia6 LOC103373795 coding downstream 210464 20102040 ~ 20113445 (-)
LOC120575253 LOC103373795,LOC104965482 coding downstream 244892 20047157 ~ 20079017 (-)
trnac-gca_26 NA coding downstream 303621 20020217 ~ 20020288 (-)
tmem98 tmem98 coding upstream 53870 20378101 ~ 20384616 (-)
kcnj19a LOC106527510,LOC107084768,LOC101480582,LOC102209712,LOC104946854,LOC100707605,LOC103469386 coding upstream 157268 20481499 ~ 20496994 (-)
asic2 asic2,LOC102794937 coding upstream 293232 20617463 ~ 21031879 (-)
hrob NA coding upstream 713874 21038105 ~ 21050607 (-)
ubtf ubtf coding upstream 750352 21074583 ~ 21085215 (-)
G156658 NA non-coding downstream 81323 20242255 ~ 20242586 (-)
G156645 lasp1,LOC102776212 non-coding downstream 108982 20203511 ~ 20214927 (-)
G156635 LOC104959536,LOC101077170 non-coding downstream 136215 20187136 ~ 20187694 (-)
G156631 NA non-coding downstream 149446 20173498 ~ 20174463 (-)
G156595 znf652 non-coding downstream 351406 19968932 ~ 19972503 (-)
G156693 NA non-coding upstream 10581 20334812 ~ 20338081 (-)
G156695 retsat non-coding upstream 14819 20339050 ~ 20340458 (-)
G156698 retsat,LOC100196171 non-coding upstream 17632 20341863 ~ 20344917 (-)
G156834 NA non-coding upstream 731458 21055689 ~ 21055902 (-)
G156825 NA non-coding upstream 747643 21071874 ~ 21073285 (-)
hexim1 LOC104946860 other downstream 22963 20299024 ~ 20300946 (-)
si:busm1-163l24.3 NA other downstream 375988 19941967 ~ 19947921 (-)
G156396 NA other downstream 1072653 19249726 ~ 19251256 (-)
G156321 NA other downstream 1202977 19108899 ~ 19120932 (-)
mrm2 mrm2,LOC102797561 other downstream 2060235 18259401 ~ 18263674 (-)
atxn7l3a atxn7l3 other upstream 740529 21064760 ~ 21071507 (-)
selenow2a LOC102798572 other upstream 781629 21105860 ~ 21108793 (-)
LOC120575154 spop,LOC102792310 other upstream 1009178 21333409 ~ 21392747 (-)
ndufa4a LOC101066870,LOC103357383,LOC101155111,LOC107378524 other upstream 1138976 21463207 ~ 21465077 (-)
G157034 NA other upstream 1296799 21621030 ~ 21622961 (-)

Expression



Co-expression Network