G162343


Basic Information

Item Value
gene id G162343
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053127.1
NCBI id CM020924.1
chromosome length 37730433
location 1013009 ~ 1013344 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU219794
gtcagggccctcatactctgcttctgactggctagtagtccttacctaggtactgtcaggacacgccctcatactctgcttctgactggctagtagtccttacctaggtactgtcagggcctcatactctgcttctgactggctagtagtccttacctagctactgtcagggccctctgactggctagtagtccttacctaggtactgtcagggccctcatactctgcttctgactggctagtagtccttacctaggtactgagcatgtg

Function

GO:

id name namespace
GO:0021872 forebrain generation of neurons biological_process
GO:0021879 forebrain neuron differentiation biological_process
GO:0021884 forebrain neuron development biological_process
GO:0021954 central nervous system neuron development biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU219794 True 270 lncRNA 0.52 2 1013009 1013344

Neighbor

gene id symbol gene type direction distance location
LOC120544177 NA coding downstream 29281 983394 ~ 983728 (-)
LOC120544156 NA coding downstream 197420 806151 ~ 815589 (-)
LOC120544167 NA coding downstream 229775 778568 ~ 783234 (-)
LOC120544137 NA coding downstream 286004 694265 ~ 727005 (-)
LOC120544220 NA coding downstream 349263 636654 ~ 663746 (-)
LOC120544169 NA coding upstream 110035 1123379 ~ 1126081 (-)
nipal4 NA coding upstream 209504 1222848 ~ 1243164 (-)
ins ins,LOC108250678,LOC103130811,LOC106937878,LOC103476384 coding upstream 231182 1244526 ~ 1246965 (-)
LOC120544175 NA coding upstream 404723 1418067 ~ 1422208 (-)
LOC120544170 NA coding upstream 474059 1487403 ~ 1490956 (-)
G162338 ik,LOC106511818 non-coding downstream 2924 989158 ~ 1010085 (-)
G162322 NA non-coding downstream 109807 902893 ~ 903202 (-)
G162320 NA non-coding downstream 114649 877634 ~ 898360 (-)
G162280 NA non-coding downstream 123200 861390 ~ 889809 (-)
G162318 NA non-coding downstream 140022 843521 ~ 872987 (-)
G162340 NA non-coding upstream 1087 1014431 ~ 1061398 (-)
G162339 LOC101480504,LOC102303547,LOC102200625,LOC103372378 non-coding upstream 5952 1019296 ~ 1024528 (-)
G162354 NA non-coding upstream 115042 1128386 ~ 1129003 (-)
G162357 NA non-coding upstream 135459 1148803 ~ 1161187 (-)
G162363 NA non-coding upstream 155450 1168794 ~ 1169404 (-)
chm chm,LOC104936337,LOC106675663,LOC101479632,LOC108251494 other downstream 122599 859932 ~ 890410 (-)
LOC120544221 NA other downstream 168151 829095 ~ 844858 (-)
G162311 rps14,RPS14,LOC100194652 other downstream 218278 786771 ~ 794731 (-)
ttc1 ttc1 other downstream 434160 570235 ~ 578849 (-)
LOC120544218 LOC103373995,LOC103459907,LOC105918498 other downstream 454087 543704 ~ 558922 (-)
G162352 NA other upstream 103729 1117073 ~ 1118688 (-)
G162358 NA other upstream 179458 1192802 ~ 1310616 (-)
G162359 NA other upstream 182769 1196113 ~ 1201434 (-)
G162396 NA other upstream 344842 1358186 ~ 1358523 (-)
G162398 NA other upstream 368417 1381761 ~ 1424401 (-)

Expression


Co-expression Network