G162352


Basic Information

Item Value
gene id G162352
gene name NA
gene type unknown
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053127.1
NCBI id CM020924.1
chromosome length 37730433
location 1117073 ~ 1118688 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU219808
aaaagtcctgattatttacatggagtctggtggagatatgctggctctatacacactaaaagtcctgattatttacatggagtctggtggagatatgctggctctatacacactaaaggtcctgattatttacatggagtctggtggagatgtgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatatgctggctctatacatgctaaaagtcctgattatttacatggagtctggtggaaatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatgtgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatatggtggctctatacacgctaaaagtcctgattatttacatggag

Function

GO:

id name namespace
GO:0044421 obsolete extracellular region part cellular_component
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component

KEGG:

id description
ko04146 Peroxisome
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU219808 True 424 TUCP 0.41 2 1117073 1118688

Neighbor

gene id symbol gene type direction distance location
LOC120544177 NA coding downstream 133345 983394 ~ 983728 (-)
LOC120544156 NA coding downstream 301484 806151 ~ 815589 (-)
LOC120544167 NA coding downstream 333839 778568 ~ 783234 (-)
LOC120544137 NA coding downstream 390068 694265 ~ 727005 (-)
LOC120544220 NA coding downstream 453327 636654 ~ 663746 (-)
LOC120544169 NA coding upstream 4691 1123379 ~ 1126081 (-)
nipal4 NA coding upstream 104160 1222848 ~ 1243164 (-)
ins ins,LOC108250678,LOC103130811,LOC106937878,LOC103476384 coding upstream 125838 1244526 ~ 1246965 (-)
LOC120544175 NA coding upstream 299379 1418067 ~ 1422208 (-)
LOC120544170 NA coding upstream 368715 1487403 ~ 1490956 (-)
G162340 NA non-coding downstream 55675 1014431 ~ 1061398 (-)
G162339 LOC101480504,LOC102303547,LOC102200625,LOC103372378 non-coding downstream 92545 1019296 ~ 1024528 (-)
G162343 NA non-coding downstream 103729 1013009 ~ 1013344 (-)
G162338 ik,LOC106511818 non-coding downstream 106988 989158 ~ 1010085 (-)
G162322 NA non-coding downstream 213871 902893 ~ 903202 (-)
G162354 NA non-coding upstream 9698 1128386 ~ 1129003 (-)
G162357 NA non-coding upstream 30115 1148803 ~ 1161187 (-)
G162363 NA non-coding upstream 50106 1168794 ~ 1169404 (-)
G162377 NA non-coding upstream 123099 1241787 ~ 1242195 (-)
G162378 NA non-coding upstream 123831 1242519 ~ 1250290 (-)
chm chm,LOC104936337,LOC106675663,LOC101479632,LOC108251494 other downstream 226663 859932 ~ 890410 (-)
LOC120544221 NA other downstream 272215 829095 ~ 844858 (-)
G162311 rps14,RPS14,LOC100194652 other downstream 322342 786771 ~ 794731 (-)
ttc1 ttc1 other downstream 538224 570235 ~ 578849 (-)
LOC120544218 LOC103373995,LOC103459907,LOC105918498 other downstream 558151 543704 ~ 558922 (-)
G162358 NA other upstream 74114 1192802 ~ 1310616 (-)
G162359 NA other upstream 77425 1196113 ~ 1201434 (-)
G162396 NA other upstream 239498 1358186 ~ 1358523 (-)
G162398 NA other upstream 263073 1381761 ~ 1424401 (-)
G162399 NA other upstream 318565 1437253 ~ 1440818 (-)

Expression


Co-expression Network